Description :
From Genome Similarity Track
Location :
contig_27:214617- 216763
Transcript NameFunction/comments
g5925.t1conserved hypothetical protein
g5926.t1conserved hypothetical protein

Sequence
2146 bases(100 bases per row)
AAAGAACCGGAAGGCCTCGCTAACCAGATTTGCACTGCGTGGCATCTTTTCCTCAAGTTTCCATGCAATGCATTTCTCAAGTTCATCCAGCGCCATGTAC
TCGTGCAGTGGAGGCGATTTCTTGGGGCCTGGAACCGCGGGACCAGCTTGATTATTTGCATCACTAGCTCGAGGTAATCTGAGTCCGGAGAGGTCTCTTT
TAATGGAGATCTTGGTGGACGCCTCCGATCGTGGTGCTTGCGAAGGCTCGTCAGCAGAGAAAAAGGTTTCTGGTAGGAAAATTCGTTGCGCGAAAGTGGG
GAAGTCGATCTCGCCCAGATCTTCCTGGTCGATGCGGCTAAAGAGTTCAGTGCAGAGTCGCGGTGTTACCCGTAGACCAATCCGTACACTTTGTTTTGGA
AGCATTCCGGCGTAATGGAGTTGGTCGTCGTGAAGAAACGGAAGGCCTGTCGTGAGTAGTTTTCGTACGCACTTGAGCTCGGGATGCTTTGGTCGACCGT
GCAGAACATGGCGTGAATAGCTTTGCGAAGCTCCTTAATCAGTGCATCAACCGATGTGATCTTGGGCACCATGGCTGGGTGCATGGTGCATCTGGATTGA
GTGGCATCCTACCAGCAGGACGGGTCGGGCGACTGGCCCCGCGTTACCGGGACCATAGCCAGCACCGCTCAGCACCAGGCTGCCCACAGGAGGCCCCTCC
ATGTTGCCGCGATGAGACTGTTGCCGAGTGCTCCAAATTCGTCGAGCGCGATGGACACAACGATCAGGTCTCGCTGCGTCGCCTTTTTGCCAAAATTGCA
CACGCCAGGCAGAGAAACGGTCGCGCCCACTGCCAGAGATACCCAGGCCAAGTGTCGGGCATTTATAGGCACGCTCCTCTGGTAGTGAAGACGTCGACCA
TCGATATATTTAGTCAGCAAGGATGAAACGCGACGGCCACTAGCGCAGATGCATGCCACGTCAACAACCTGGTTCGGTCTCGTCGGTGAGCGTTGATCAG
AAACTCTGCTGGCATCCAAGTATCTTGCTGCATTCAATCACGCTGGAATCTTGGTCCACAACCGTTTTCTAGAAAGCCCACAGTCTAGGCCGCATAAGTG
AGCTGCACAATCTCGCGAATGTTGGACTTACAGTCGCGCTCTTCCCACACGGTTTCGGCTCGGAAAACCCCATCGGCTTGCACGAGGCCAACAAAGTGCT
GCACGCTTCCTCCAGTGCCGAAATAGTACTTCTTCGCAGCTACCAACGCTCTCGCATTTGGAGCGCGGCGCAAATGCCGCTTGATGGTCTGCAGCATTAA
AGCATCAGTCTTGTATAAACACAACAAGAAAAAGGAAATAAATCACCTGGTACAATTCCACCGCCACGGCCTCCGTGTAGATGGTCTCGGCCGTGAGGAT
CAAGTCGAACTGCATCTGCTCCTCACTCTGCTGCTCTACGTCCTGCATGAACCGCGTGACGCTCGTCCAGGCGCCGGCGTAGAACGCCGCCTTGCTGTCC
AGCTGCTGGACGTTTCTCAGCACATTGGGGCACGTCGTGAGCTCCAGCACCTCCTTGTTGTAGTCGCTGAAGACCACGCGCTGGGCGCCTCGTTGCAGCG
CGTGGATCCCCGGCAGTCCGTGGCCGCAGCCGAGTTCCAGCACGGCCGAAGGCATCTGGGCGCCCGATTGGCGCAGCTGCGTCTCCACGAAGGCTACGAG
GTCCACAGCGCATTCCCAGAGCTTGAAACCTCCTTCGTACACGCCTGTCTGCACGTCGGAAGTGGTCAAGATGGAGCTGATGGCCCCTGTACGCGCCAGG
AAGCCCGCGTCCGTCGTATTGACGATCTCGAACGTCATGTCGCCCACTTGCACGGCGGAAAAGGCGGCGGACGAATGGGTTTTGGGGGAGAAGAAGAAGC
GCTCGCCCATTGCGCAGAGGCGTAGCAGCACTGGAAGATGCGGTGAGGGGCGTGGAAGGCGCCGAGGACGCCGGCGCGGCGCCGTCCAGCGCGAAGTTGA
ACGAGAAGGACATGGCTTCACAATAATGCAGGAGTGATGGCTGGTGTCGTTTGATGTGGCGTACACCACTTGGTTCACACTATGTTGGGATCTGGTCAGT
TAAGGATTTCTGAGTCTAGGATGGCGTCGCCGTCACCTTCGCCTCG