Description :
From Genome Similarity Track
Location :
contig_53:214562- 216219
Transcript NameFunction/comments
g10808.t1hypothetical protein
g10809.t1GAX93545.1 Hypothetical protein PINS_001449 [Pythium insidiosum

Sequence
1657 bases(100 bases per row)
GGGATGTGAGCCGCCACTTCTCCCCACGAGTGGCAGCCCTGCAGCACCATCTGCTCCAGCGTGCTGTCCTCCTCGAAGGACCAGTGGCCTTTCACGAGCC
CCGGCTTGAGCACTTTGTTCCAGCGCTGTAGACACTGTGCGTGGTTGCGGCCGTCCACACGGGAGGCGATGGCCTTCCAGTTACGCTGGCCGAACTCGTC
CACCGCTCTGCGCAGCGCGTCATCCTGCCCGGGCGTCCAGCGCTTGCCCTTCTCCTCCTCTGCGCGGGGCTTCTGCGCATCACTCGGCACCTCGTGGAAC
GAGCGCAACGCGTCATCGCTCGCGTCGCGCTCGCGCTTGCTGCACAAAAAATAAATAGGGTTCGCACACATAAGAATGGGTCCGCACACACAAGAAAGTG
CTGCGCGCGGAGCTACGCACAGTGCAGCGTCCGCTGCGTGATCGTGACAGTAGCAAGGCAAAACAGGTCAGAACACGTCACTGGGGGCAAAGTGGGCACA
GGGAGCGCACCCATAGTAGAGATCGAGAGCTGTAGGTTGCAACGCGCTGCCTGGCGCTGGTGACAGAGTGCGAGGGGCGGCGCACTCAGCGGTCGACTTG
TTCAGGACCGCGCCGGGTTGCTTATGATGACCCCCCCAGCAGATGCCGAGAAAAACACGACTTTCGACCAATCAGCGCGCGGTCAGGACCTGCGGAACTT
CAAGTTGACTCGTGCTTGTGTAGTGTGTACACTTTGCCGGTGTTTGTCGTGGGCTTGTGTGCTGTGCAACTCGTGTGCTGTGCAATCCGCGGCGGGGTTG
AAGTTCGACTGGCCCGACCAGATCGGTGCTGGGCTTTGTGGCCGTGCCGAGTGAAATGCGGCGTCCGTCATGGCGAGATTTGGCGTCGGTCTTGCGAGCG
CCTTGGGCATATGCAGGCTTGACAACACGCCAGTGCTTTCCATCTTAGAGTTTTATTGTTATGTGGCATGTAGGCAACGTTACTCGGCGGCACCGAAAGT
TCAGCTTTGCACGTCGTCACCAAGCACCACTGGCGAGTGTGACCAGCCGCATTCAAACGCGAGCCCAGCAGAACATAGTCGTTGCCACGACAACGACGTC
GCTTCCGCGGTGGACTTGGCACTCCATGTTCTACCGCAGACTACGGCGTTGTCGAGCCTCGTTTCCTAATGCCGGGTATCGTCGGTGTTAACTGCATAAG
TGCTCGCACAGTAGTGGAAGTCTCGCCAACGCTGGCGGTCCCCACGATGAGGACCCCACGATGAGGACGACCCTTTCTGTCGCTGCGACTCGATGACGAC
GGAGGCGTCGAGGCAAATGCGTGGCACCACTGGCGGGCTGTGCCTTCGAATCGTGGGCGGTCTCACATCATTCGTTTGTAACGAATGCTGTGCAACTTCA
GAAACCTCTGCATAACTGATATAACGTCAGTCGAAATCGAAGCCCTCCTCTCTTTTATACATGTATGTACTCTATGTCCGCATGCCCCGTTAAATCCGGT
ACATGTATCTATATGGTGCGTCATTGTGTATCATCTCCAGCAGCCCCCTCTTGGAGAACTCACTCTGCCATGCTGTCGACTAGTAGCGCTGCTGCAATTC
CTCGCGCCGTGGACACTCCGTCCAAGAAGGTTGTGCAGACTATCGATGGCCAGAGAA