Description :
From Genome Similarity Track
Location :
Scaffold_163:21453- 27937
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_163-abinit-gene-0.39SET binding factor 2 (LOC559753), mRNA
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.11CofD
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.5Rab32 family GTPase

Sequence
6484 bases(100 bases per row)
CGACGCCGCATCCAATTGACAAATCAATCGAGAACTTCCTGGTGCCGTGGTCGGACGATCCACAGAACGTCGTGCTCACAGCGTCGACGTGTCCAGCGCC
GATGGCGTTCAACTTCCGCATGGGCGACAGCTCGTCGTCCACTGAGCTCTTCGCAGCGTGCGTGGTCATTTACAAGCCCGCACCGGTTCTTTCAGTGAAG
CAGTTTGAGAAGCTCCGTCTGGACGCCCAGGGCGGCAGTCGATGGGTTCCCTACGGCGTCTGCATCGTATCCAAGTTCCCGCTCATCGACCTGCTGCGCG
AGCGGCTCGCGGAGGCGTACGAGTTCATCCTGGAGCTCGAGACCATCGAGGCTGCGAAGGAGAAGCTGGTTCGAGCAGCCGCGGGGTCCTCATCTCTCTC
ACCGCCAAAGTCCAACAAAGAACCGTTCTCACTCGACAAGAAGGTGCTGTCCAAGGTTGCAAGGGCCGTATCGCTCGAGAACATCTCGCTGTACCACCAA
GCTTCTGTATCGTCCTCGTCGTCTTCCTCTGTGCCTTCACCTGCGTCGTCGTCGCTCGCGGGATCTGTAGCGGCATCCTCAGCGGCGATGCTCGCAACAC
TGCCGCGTCTCGACCATTCAATCCGCATCCTCTTTGACACACTCGACATCTCGACGGTACTCATGGTGTTCACGGCCGCGCTCTTTGAGAGCCGCATCCT
GTTCATCTCGTCGTACCTGTCGGTGCTCATGAAAGTAAGCGAGTCGCTGCGCGCGCTCATGTACCCGCTGCTGTGGCCGCACGTGTACCTTCCCATGCTG
CCAAAGCGCATGCTGCAGTACCTCGAGTGCCCGACGCCGTTCATCTTTGGCGTGGAGAAGAGCTCGCTCGACGAAGCAACGTTGAGCGAGCTGCTCAATG
AAGACATGCTCGTGGTCGACCTGGACAAGGGCTGCGTGCTCCGTGGCGAGATCCCGTGCTCGCTGCCAGAGAAGATGCTCTACGGACTCCGTGATGAGCT
CTACGAGTGCCTCAAGCCGAACGTGAGCAAGAGCGACCACGTGTTTGCCAACCACTTCCCGACAAAGCCGCTCGTCTTCCCCGAGATCGCGGTGCGCTCG
CTGTTCTACAAGACCGTGCACAACCTCATCGGCGACTTTGGGTATCACCGCTACGTGTGGACGGACGAGTATTCGAAGAAGAAGATGGTGTTCTTCGACG
AAGCGAGTTATCTGGCGGCGTCATCGCCTGACAAGCGCGAGTTTCTCACGCTCTTCATCGCGACGCAGGCATTCAGCGAGTTTATGGTCTCGTACCACGG
TTTTGAGGACCAGATCGGCGCGACGCCATTCCAGACCACGCCCATCGCGTGAATTGTATATGTCTGAGTGTGAGTGAGAGTGATGCCTTCTGTAGATGGA
GATGGCGAGAGAGATCAGCGAGCAATCATCACGCTCTTCATACCTGGTATGAAGCTCAAGTATTTATATTGGCTGCCGTTATGGTCTCGTGGGTCGTCAC
ACCCAGGAAGGAAAGGAAGGAGCTTCATCCGTGACGCAGTTCCCCGATCGCTGTGGTGATCGCGATAAGCGCGACGAGAGCTCCAAGTACCACCGCGCTG
CCTCGGCTGGACGTTGTTGTGGCTTCGTTCGCGAAGTCTCGTGGCTGCTGTTTGTCGTGCGAGTCTCTACTGCTGCCGCTGCGATCTGGAGCTTGACTTT
GTCGAGTGCTTGCTGCTGTGGATGGAGAAGATTGGTGGCTGTAGCTACTAGCATGTGTGGTTGGTGTCGCCATTGTCGGCTGTCGTCCTCCGGGCGAGAT
CCCGCGGGGCGTGAGTGGGATCCGCGGGTGGTAATGGCCGCCAAGCATCAGTTTTGCCTTCATCCCCTCTAGTTCTTGATCGATAATGCTATAGAGCATG
GCGACGACCATTTTCCCACTATGTTTGATCATGGGCGTTTTCTTCCACTCTCTTGCCGCTTGCATGTCGATCTCTTCAAACGTTTTCCCCTGCAGCAGCA
CGGGCTTAGCGCGCTCCGACATGTCGCCTATTGGCAGTAAAAGCTGCTCGCCGCGCGCGAAATACGGCGCGAGCATGTCCGACTGCGGGATCGCGTTGTT
GGCGATTACGTAGTCGATCGCGTTCTCGCCCAAGTACTTGCCGAGGATCTCGACCGTGTCGCTCAAAGTGTAGCCATCAGTCTGTCCGCATTGCGTTGCG
ACGTTGCTGATGTATACAGTCGCGCCAGCGCTGCGCTGGATCGCGTCGCGGATACCTGGCACGAGCAGCGTGGAGATGATCGACGTGTAGAAGCCCCCGG
GGCTGAGTACGATGATGTCGGCATTCTCGATCGCCTTCACGGCCGGCAGGAACGCGGAGACGTTCTCGTTCTCGAGAAACACGCGTTTGATCGGCGCTTT
CTTGCGTTCTTCACCGGTGTCTTTGTCCACGACCGTGGGGCTGCGCACGTTCACCTCGGACACGACGACCGAGCCGTCCTCGAGCTCTGCGCACAGCTCC
GTGTTGTCGAGCGTGGCTGGCAGCACGTTGCCGTGGATGTTCAAAATGTCCGAGATCGACGTGATCGCCTTGTCAAAGCCACCTTGGATATCCGTGAGCG
CGGCCAGCAGCAGGTTGCCGAGACTGCAGCCCTCCATGAAGTTCTCCTTGAAACGGTAGTTCATGAGCTTGTTCATGAGTTCGTCCGAGTCGGAGAGCGC
CACCAGACAATTGCGAATGTCTCCTGGCGGTAAAATACCCAAGTACTTGCGAAGAGCTCCCGAATGTCGACCCGAGTCAAAGACTAAGCAACAGTAACAT
ACATAAAGAAGATACGATGAGAATCAGTCCATCTGAAAAAACTAGACAAAGATTTCCACGTTACCAGTGACAATTGCGGTGAGGTCAGCTGGGTAGTTGC
GTAGCTCCTTCAGCAGCACTGCGAGTCCAGTACCACCCCCAAGAGCTACGATCTTTGGCTTGATCATCTGCTGGTCGGCGAGCCGGACGATCGCGATCAC
TTCTTCAATTGACGCGATCTGCCGAAGCAACGATTATAAAAGTTGATCAGTTGATGAGAGCTAATACACGGATCAATCGTACTAATCAGTGAACGAACCT
GGAAATCGGGCTGCTCGAGCTCTTCGATCGGCATGACACTCGTGTACTTCCCATGCAGCTGTAGAATGACCAGATAACATACATAGGAGTGAGTATCCGC
GTGCAATAAAACTCTACAAAATACAGCAGCATTGCATGGCGTCATTGCTTACCATTCGCGCAGTAACCATCCCGACTTTGTTTGCCGCCTTGATCTCATA
GAACACTTTGCGACCGACAAAGAGGATCGACGACGGCTGCAGCATCAGCCGCCTTCCGATCTCCTTCATCGCCTTGGTGAGCTGCTGGATGCTCGGATTG
CAGTCCACGAACGCGATCTCGGGGAAGAAATCCTGCAGTCCAAGGGTGTGCAATCGCTCCAGCTGTACCTCTCTTTTCCCCACGAGCACGAGTCCCAGCT
TGTAGCCTGCGTCCGCGAGCGTCGCGAGGGTGTCTCTGGCGCGCTCGAAGGGTTTGATCGAGCGCGCTTCGGGGATCTGGCTCTCGTAATACGCGTTTAC
AACGCGCACTGCGCTCTCAGGAGAAAGCTTGTTCTGTGTCATTAAGCTGTCGACAAAGCGTGGGAACCGCTTGCGGTATCCGTACGCATTGCGGAACGTC
TGCAGCGCTTCGAACGCGGCAGCGATGGTGGGGAATGCGCGCTCCTGGATCAGCTGGTGGACTGCGCGGTCGATCGCAAAATGCGCGAGCATGCCCGTGT
GATCATAGAGAACGTCGTCCAGTATCATCACGACAGCGTCGATGCGTCTCGGGTCGTCGTCGACGCGCTCGCCACTGGGCAAGCGGCAGCGCGCACCGCG
CTTCAGACTGCTGCTTAGCGCAGGCGTCTCTGGCACTGCAGCGTTGCCCTCGCTGCCGGTGCTGCCGCTACTGAACGTGCGGATGACAGGGCACATTGGC
GGGCGCGCGTGGCGAGTCGCTGGTGCTGATGCATGTCCTGAGCTGGTGGTGGAGGCGGTGGCAGTCGCGCCACGAGAGGATGCATTGGACGTCGCCATCT
TGGTATGTAATGACCGCGTAGCCATCCTTGTCTGATTGGAAAGACAACAACAGGCTTTCCTAATAGGAAAGCCTGTNNNNNNNNNNTGTTTTGCATGGAA
GAAGGATCCACGCAGCAAATGTAAATGCAAAGGGGATGCTATAAACGAGAATGTCTTGTGTTGAAATTACACTTTTCATTGGACAGGTATCTCCCAGTAT
GCAAATGTAAGGTAATTGGAGAGTTCAGTAAACCGGTATTTGGACAGACAAATCTTGCGGACAATGGACATCTCGGCAAAGTACCATTTTCCAAAGCTAT
TGCTGACAGCCATTCTTCATCTACAACCTCAGCGAATATATGCAGTACACATACCGACCTACCGGTATAGCACCAATATCGAGCGGAAGGGATTCCTCGG
AAAGAGAACACACTTCCCAAGTTGAACCCGCAAGACGAGAGAAGACGAGAAAGATGGCCGAACGCCGAGTCAACGCCGCGCAGGACGCGGTCATCAAAGT
GCTTGTGCTGGGCGACGCCGCCACGGGCAAGACCAGCATCATCAAGCGGTGCGTTCAGCTGTTTATTTTGTTGCTGTTGTTGTGTATGCCAACCTCCAAT
GCGTGCTGAAAAGCTAGGAGAGGGAAGGGAGGAAGAGTATCCATTATGGATCCCTCGAGGAGCTACATACACTTAACGGTCGTGTTATGGTTGAATGTGC
TCTCTTTTTACATGATAGATACGTGCACGACGCGTTTTCGGAACACCACCGCACGACGATCGGCGTCGACTTTGCGCTGAAGGCGGTGACGGTCAGCGGA
ACGACTGTGCGTCTTCAGTTGTGGGACATTGCTGGTACGTGAACAAGAGAAAGAGAAAAGCATGATTGAGTCGAAAACATCCATGTGCATTTCACTAATG
GATCTGTATGGGTTTCTTCTTTCTCCTTTCTGGTCGCAGGCCAAGAGCACTTCCGCGCGTTGAACCGGGTACGTATACGCTTGAGGGTCGGGTGGCAGAA
GCGTGATGGACTGATGAAGCTGATTGGGTTGACTGTGGCATTGAACAGGTTTATTACAAGGACGCACTTGGTGCGTTGCTGGTGTATGATATCTCCCGCC
CAGAAACATTCGAGAGTGTGATCAAGGTAAGACTGCTGCTTCTTGACTTGCACTATGATTAGAGAAATCGCAGTGAAATTGATGCGTTGCTTGTGTGCTG
CAATTGAATTTGATTGCATCAGTGGAAGAAGGAGATCGACACCAAGGTACGACGCTATCTCTGCGTAAGTATAATGGATTGATTTTCTGACGGATGTTGG
CGTGTTTAGGTCGAGCTCCCAAACAACAAGCCGCTGCCAGTGATCCTGTGCGGCAACAAGGTGCGATGTTTGCTTTGGTACTTTCTCTAGTAGGAGAGTG
ATTGTCTCCCATTCTAATCGATATGCACTTGCGTTATGTGACAGTGCGATTTGTCTGGGGACGTCGATCGCAACTTTCTCGACGCGTTCTGCGAAACGAA
TGGCTTTGCTGGGTGGTTCGAGACGTCCGCGAAAGAGAATAAGCACATCGACGACGCCTCCAAGGCGCTGGTGAACAGCATCTTGGAGCACCAAGACATT
TTCGAGCGCAAGTCGGATATCAGCAAGCGCAACGACACTTTCCGTCCGTCGCACGCGGATACGCGAAACTCGCAGTCGAGCTGGTGCTGCAGCAGTTTCT
GATACAAACCTGAAGCTCTGCTGTGCCGGTGACAGGAGGTAGCGTTGTAGTGCTTGGCGGAACCTCCACCACCATTTATGAAACGGAAGCTGCTCCCTCT
AACGAGCACGAAGTATGCACGCCAAGCGAAGATTTGTCAGTTGAGCCACTCACCGAATAACACAAAACAAGAGCTAACATGAATAATCAATGTCCCCCCC
CCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCATTGTGTTGTGAGCGATTTCGCAATTTGCTTCTTCCTATCTGCACCACCAAGTTAGCCACACTG
TGAAAAATGCTGCACCAGATTTGGGCGATCGCCATTTCCCATCCACTCCCCAGCAACAACATCCGTCTGAACAAGACAGTCTCGTGATACGATCCCATCG
GCGAACGATACTTGAATCTCTGACGTCGCGCACTCGAGCTTCAGACTGTTGTGGAGATATCGCCGCTCGCTGTATCTGCCTCTTCGGGGAGTAATAATGG
ATCCGATGGTGTTGGTGACGCTGATGTACGGTTGTGCCGTTCGCTCTGGCTGGAAATGGTCAGGGATCACGGCTTTGTAAGCGCGCGGGATGAGGACACG
CTCAACCTCAGACTCAGCGTCTACAAGGTCTGCATGTAATGGAGCGGCGGTAGGGTGGCTAGCACTTGTTCCTGGACTCGTCGC