Description :
From Genome Similarity Track
Location :
Scaffold_253:21450- 25552
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_253-fgenesh-gene-0.4Dynein heavy chain

Sequence
4102 bases(100 bases per row)
AGCGCCTCTTTCGGCCACGCGTGGAACCAATCAATCGCGCAGCAGCTCACAAGAGACGGGAAATTGCGGCACCGCACACGTAGATCCGAGCCCACGGGCG
AGAATGCCAGGATCAGGTGCACATTGCTCCTCACGCGCTCGTAGAAGAACTCCTGCAGCTGCTCTTTTGTATCGGGGATGCCCTTCGCCTTGGCTTCAAG
CCGCAGCGAACTGATCATCGCGTCCATCTCTTCGACGCCAAAGAGGTCGGGGATATACCCGGAAGTCAAGAGATCGTTCAGGGGCACGAGGAAACGCGGA
TCGCTCAGCTGCGAGTCCGTGAGCAGCAGCACGAGCGGCTTGGCGGGGCGGATCCCAGCTTTCCGGTACACGTCTTTGAGGTCCTCCTTTAGCTCATTCA
TGCCGTACGTAGGCGATGCGCTGACGCTCAGCGTGCTGAGTGCATATCCGCAGATGAACGCTGCGAGGCGTGAGAGCGACTGCTTTCCTGAGCCACCAAC
ACCGATGAGCAGCGCATTACCCCGCGGGTTGGACAGAATGCGCACGATGCGCGTGATGTGCTCGAGCGCCTGGTCGAAGAGCACCAGGTTCATGACCGGG
AACACGTCGTTGTACTCCTTGAGCTTGAGTTCCAGGCACGAAGTGAGCTGGGACTTCTCGAGCACAGGCGCGTAGTTGACCAGCACCGAGTCTTCGCCAT
CGTTCTCATTGCCACTCGAGCTTGAGCTAGAGCCGCTGTTGAGAAAGCCCACGCAAATGAGTGGCGTCGCAAAGAGCTCGGTCTGGTCTTCCTCGAGATG
TTTCTTCGTTTGCTCAACCGCCATCTCCGTGAACCGCTGGATCTCGCTCGCCGTTCCCATGCGGTCGCTGAACACGCGGTAGCACTCGTGCAGCCACATT
CGCGCAAACTTGAGCGAGTGATTGAGAAAAGACTCGGGTTTCGACATAAAGAGGCCCTGGAAGACTGCACTGAGATCGCGCATGCTGAACACGTGGTGGA
ACTTGGTCGCCGTCGGAAGAAAGTTGGCGCGCACGTCGTAGTACAAGTCGATCGATGCGGCGACGATCGATGGCACGAACTTCTTGATCTTGTCTGAGAA
GTTCACCAGATGCTGACTCAGCAAGCTCGAGTAGATCATGGCCAGGTCCTGTTTTGGCGGGATGTTGATGCACAATGTGGAGAAATGGCGCTGCAGCCGC
GGGTTGATCGTGAACGAACCGGCCTTGTGGTTCATGCAGCTCAGCAACTGCACGTCCTGGATCGTTTTCTTGACCGTGAGATCGTGGCGGTCGTACCAGG
CTCCGTAATCCATGTACTGTCGCAGCAGTGCCAGCGCCGTCTGCGTGCCGTACGTCTCGGCAAATGGCATGTTCAGGTCGTCCAGGAAGTAGATGAGCTT
GCGGTTGTGCGCGGGGCCAAAGACCCGACCCGACCGCTTCTCCACGTATTGCTCGAGGCGCAGTTGCAGCTGACGGGCGTCCATGTAGTGGTGCATGTTG
ATGTACGCCGACACGAGCTCATCGTCCAGACCTCTGAGGTGGTCCTGGGCAATCGAGGACTTGCCCGACCCACTGCAGCCAACGAGGAGGATTGGGTGCG
AGCTCTGCAGCAAGAGGTCCATGAGCGCGTGTACGCGCGTGGACTCGACAGTAGGGATGATGAGTGAGTAAAACGGACCGTCGCCACTCACGACGGTTGA
TACTGGCAGCTTGTCGCTCCAGGGTAATACCTCGTTCTTCACGACGTCGTAGTACAGATCAAAGAGACTCATGCTGTGCACTGACATCGCGTCTCCTGAG
CTATTGTTACTGGAGGTACTACTGCTGGTATTCGCTGGTACTGGTGGCAGTTTGTACTTTGCGATCGACTTGAGCGCACTTGAGAAGACCTTGCGCTGGT
CGTTTGCCTTGTCGCCGTCGAGCGCGCCGCCAAACGCCCACAAAGCGCAGTAGATGAACGCATTCTCCATCACATCGGGCGTCTTGTCCTGTTCGTTCAC
GATGCGCAGCACACCATCCAGTAAGCGACACAAAGTCTCGACCATCGCGATCGCGCTGATCGGCACTATCGGCTGCAGTTTGCTCTCACGAAGCAACGCA
AAGAGTGCTTCGACGTACTTGGAGAACAGACCGGGGAGCACTAAGCTCTCACTCGCACTGACACGCTGCTGTACCCAGGACTCGACGAACGGGTGCCAAC
CAATGTCTCCATCGTGCACGTAGATGATGCCCGCTCGCGAGACTGTCGCTGGTGTCGCGTTCACGAGTGACGAAATCTCGAAGACCAGTCGCATCGAGTG
GGTGAGCGGAATGCGCTCGTTCGACACCAGCGTCAGCACTTTGTTGTCGTCCATGACAGTGTTCATGCTCTCGATCCAGACAGCGTCGATGTCACCGTCG
AGTACGACCCACTTGTAGTTCTGGGACTCGTTGTATGGGGCGATATCCTTGGACATGTTGCGCATCACGGAGGACAACACGCCATCTTTCCAGTCGTTGT
CGAGCGTCATGTACCCGTAGAGCTCGTCGGCCGTGATGGCCTTTGGGTTGACGCTTTCAAACACCGTCACGGGCTTCACAGCCTCATTACTGCTACCTAG
AGTAGTAGAGCACGAGGGGTTAATGTTGTGGCAGGCAGCAAGCGTCGTCCATATCGTGCTCTTGCCGCAGCCTGCGGGGCCGATGAGCATGACGCTGTGT
CGCACCTTGAGCACGTCCTCGTACTCAGTCACTTTCTTCAGGAAGCCTTCCTCAGCTTGGAGCTTGAACTGCTGGCAGATCTTGACGCATTTCGCCTTGA
GCACGTCGTTGTTCATGTGAGGCAGCTGCTGTTTGGGGAACAGGTCGTTGAGCAAACCCAGGAACACCGGGTAGTCCGAAGGCATGATCTTCGGTGTATT
GAAGTCCCGCAGTACCTGCATGAGCACGACCTCTTCCGAGAGCACCACCTGCGCGCGTCGTAGACTCCCCGCGACGAGCAGCACGGACTTGACAGCGCGC
AATCCCCAGTCGTAGTGTTTCTGCTTAGAGAGCAGCTCGCTACTGAGGTCGTAGAGCGTCACAAACTTGACTGACAGTGCACGAGCCTTCAGGAAACCTT
CGGCCATGAGCATGTTCTCGCAAATCGGCTGCAAATCCGGTTTGATCATCGCGCAAGAACGGAAGAGCGCCTTGAGGTTCTCCGGAAGCTCCGCGCGACC
GGCGTACCCGGGGTTCATCGTGATGAAGAACCCCACGGTGGGTACGAGAGCGATCGTCTTGCCGAAAAACTCGCACGTGCCTGAGCGCGGCATGACCATA
ATCGTCGACGCGGTACTCGCTTCGTGACCGCCTTCGCCTCCTGATGATGATGCCGCCGTGGAGCCACGAGGAATCGCCAACAGCGTCGTTGCGTCAAGCA
CAGTTTTGACCTGGGTCGCCACAACAGACAGCACCTCCACTGAGATACGATTGAACTCATCAAAGCAGCCCCAGGCGCCAGTCTGCGCAAGCCCTCGGAA
GATGTCGGCCATCGTCTTGTAGTTCATCTGGTCGCTGCAGTTGAACACGTAGCACTGGAGCCCCATGCCTCTTGCGAGGTCCTTCGTCGTCTCAGTTTTT
CCCGTACCGGCAGGACCAGCGGGAGCACCGCCAAGACAGAGGCGCAACGCCGTCGTGAGCGTGACGTAGCAACGATCTGTGAGCGGCGTGATCACCAAGC
GTCCGCAATTGCCGCTGTACTCGTAGCTGTAGAACGAACGGAAGTCGCAGATCTTGATGTGCACCTCTTTCTTGTTCCCCGTGCTCGTGGACACCGTCGC
GAGGTAGTAGCGCAGCTGAGACTGCCATTGGAAATCGAGTGACGAGTTCACTTTCTTTGTGATGAGCGACTGCACGACGTCCCGCGCGTGGACGTCTACA
GTGATGAGCGTGATGATCTTTTGCCGGTCGAGCGCGCGCAGTTCGCCCTGCACGAGCTTGATGAGCTCTTCGAGGCGAACGGTGGAGACGTCCCAGTATT
TTTTCACTGCGTCCTCAGTGCCATTCTCGAGCTCTTCCAGCGCGGCTTCGACTTCTTCAGTCCACACAACCTGGCTCGCGAGGAGCGTGACCTGAGCTGG
AT