Description :
From Genome Similarity Track
Location :
Scaffold_219:21448- 22679
Sequence
1231 bases(100 bases per row)
GAGGCTTTAGTCTTGGAAGTGCCAGACGTGGATAAACCCTTCTGTTTCTTCTGATATGCGAGTTATTTCGACATGGGCAGTGCCCATATACAAATGACGA
AATCATTAACCGCGCCATCGCGTAGCAGTCCTAGATTTTAGAGGCCGCGGATCTGAGATACCCCGTGAATGATAAAGATCTAATTTTTTTAAGTATGCAG
AAAAGGTTCGGTTCCCAAAAGGTGTACACGGAACTTTACAAGAGCATATAAACGAGGTTTTGTGTGCACCTGTTGAGTACTGAAAGTTTTGTAGTTTACA
CGGATAACTTGCTGCGGACCGCGGTTAACTCACCGCCCCTATCACCTACGATAGTGATATGGCTCAGGTTTTTTTTAGAATTTAATTTTCGAGCTGAATA
CAAGCCGGAGATGTGAACCATCTTGGCTGACGCGTTATCGCGCAGAACCGACTTCGAGAAACGACACCTTGAAGACTTTTCTCGTGCTAAAGCACAGTTG
AGTAGTTTACGATGGCATTATTACGGGTTGAACATGTGACAAAGACTCTGGCCTCTGATATAAAGGAGAAATAATGCAAGACAAACATTGTCGTCTGCTT
TCAAATTACTTTGGTGGGCGGAAGAGCACGCTTCTGACGCAGCTAAAGGAAATGTTTAACTGCTTCTTAAACAGAGAACATATATCTCAAACAGAGTATT
CTCTACGATCTGCATGATGCACCATCAAGTGGTCATCTGGGCCGTGAGAAGACACGTTTAATCAGTGTCAGGTGAATATTGATGGCCCCACCTATATTGA
TTGGTAGAATACTGTATTCGATCATGCGAAGAGTGTCAGCGCGTAAATCCTGTTGTTTCTGGTAGTGCACCATTGATGCCAGTGCCTATATTAACTGATT
GTTGGATATCGGATAGTTTGGACTCCATGTTTGGTCAGCCGCCTGGACACAAAGGTAGGACTGGTCTCTTCATATTTTCCGATAGACTGATCAAGATGGT
GTATTTAGCACTGTGCAGTACAAATATCTCAGGCAAGATGTCAGCTGTTATTAACTGGAGGATCACGTATTTCGACTACACAGGGTGCTCAAGTCCATTG
TTTCGGACCGGTGTCCACGTTTTTACTTCAGGTATTTGACGTTATGTGTTTAATCAGCTTGGTAGCAAGTTTCACATATCTACCGCCGATCATTCCCAAA
CTGATGGCCTGATCGAACGGTCCAATCGTGT