Description :
From Genome Similarity Track
Location :
Scaffold_453:21447- 26607
Transcript NameFunction/comments
g15305.t1hypothetical protein
g15306.t1hypothetical protein

Sequence
5160 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAG
TAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAAC
CCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCTTTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTT
AAGTGAATTACCCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTC
CGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGACCAAACACGTCTG
CAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAAC
GATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTTTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTTGCCA
TCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTG
CCATTACGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGCCGCCGACT
CACAGATCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAACTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTC
CTCGATCTGCAACAGGGCAATCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAA
AAGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAAT
GCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATG
GACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGTATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGT
GCACAGCACCTGTGCACGCGGCGAGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCT
GCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATTGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGC
CGAACCTTGTCATCCTGAAAGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGCCGAACAACTTTGTTCGACTGCAGAGCCT
TCCAACGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGC
GTACGCTTCTCTTACCACGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCAC
GGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAACAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGC
ACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCTAATAACCCCAAGCGAACGTCAACGACTGCAAGAGTCGTTGGAAGA
AGATGTGAAACGAATCAACAGGGCCCGATTCAATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCAACAGATAATGTCGACACAC
AATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGTTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAATCGTCC
CGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTACGCGATCAAGCCGGGCTTAAACGCGTGCGCCCGCGGGTAGAACCC
GCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCAATCAA
AGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGAAGACCGTCGAGACATTGAGCGTCTTGAC
GCGTACGAGTATTGGTCTCCAATACAAGAAGGTGAGGCTGGATAATCCCCCGACGTTAGCGTCGGAATTGATGTCGCTCCCAGTCACAAGCTGGAAGCGT
TTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACATGTGAAGCAGAAGAGCTGAATCAGCTCATCT
CTGAGGGTGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAAGGTCTTGC
GTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTG
CGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAAGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCC
CCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGATGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGA
CGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATCCTCATGTG
TGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATACCGCAGGGGCTGAAGAACGCCCCAGCGACGTTC
AACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTATTCATTCACAGCCGGGCTGTGAATGGGAAATCGG
ATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGGGCAACCGA
GATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAG
AAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGG
CTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAATCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCC
ATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGT
CAGCTAAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTA
GACCATTCGTGGTTTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGA
ATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAACGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAAC
GCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAAT
ACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCAGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAG
CGCAGTCGACGACAACGCAGATCGCACTGTCGTGCCGGATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGAGACAT
CCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTATTTTAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCC
AGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTTCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGAACTTTGTTTTTGGTCT
TCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAA
CAGACGGCATGTCTGTTTGTCGACACGGTGTTTAGACACCATGGTATGCCACTCGATATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGC
AAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACCGAGCGTGTCAACCGCGTGTTGGTTGA
CACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGA