Description :
From Genome Similarity Track
Location :
Scaffold_3:2144690- 2152799
Transcript NameFunction/comments
Physo_263679Hypothetical protein

Sequence
8109 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGTGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGC
TGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCATAAGTCTCTATGGACCACCCGTCGTGG
TGGTCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGGAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACT
GTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTC
TTCATGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCGCAACAGAGGGTAACCTCTATGTTGCTCAGTA
CCATGAGCGCCAGCAGACAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGAGATTGTCCTCGAAGGTTCCGCTTTAGTCAAC
GACGCCGTTGACTACGAGAGTGATGACGTAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGC
ATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGATTCGGACGCTTCAAGCTCGAAGCGTTCGCGCGGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGG
CAATAAGCTCCCCGCGTGAGGTGGCGTCTTCAAATTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCG
TGTGGGCAACACCGTGCCTCCTAATGAAATACCGCTGTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCACCTTGATCCGTTAACG
AATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCAC
TTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTC
GACGCGAGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATACGCTGTGCCCGAAGGCCATCAGTTCACGATGTGTCTTCCGGGT
GCGGTGCGCTTGAGCGACCGCGACCTAAACGGGTATACGACGATTCGTGTACCTGAGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGCGAGGAAC
GCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTATGCCCACACCATTTCC
GGAACGTCCTGCAGCAGGACGTCCCATGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAGCGAATACGATAACGAACCGGCTGCCGGTTCGTTT
TCGGGATACTATGGTTCACAATACGCTCAACAATTCAGCGTGTTGGGCCGCAGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATG
GTCAACCAGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCATCAGAGCCGGGAGTTCGCCGCTCTGATGCAGGAGGTGGC
GATCCTGAGGGCTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCGATGTGGGAGGTCGCGTCGCACGCTTGGCCCAGCGCGTTTACGCG
CTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCAGGTATGGCTTCAGCCGCCCGACGTAAAAGGT
CGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAGCACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTC
GCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATCAGTGTTGCCCCTACCAACATTGT
CTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTTTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCT
GAACTCGTTCAGCTCGTTTCTAGCAGTTGGCCTGGCCGCTGCGTTTGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTCTTG
CTCTTGTCGACGTCTGTGCACTGTACAGACGCGTGCTTCTTCTTCTTGTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGACT
GCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGG
TGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCTGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGCGCGTAGCTCTTAAGC
ACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCAGATGATCCGCAGTCGACATCGAAAGTTGACTCCCAAGAACTGTAAACACTT
CTTGTCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCTGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGT
CTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGG
GGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACAC
GTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTCTTGCGTGAGAAGAAGGTATGTCTTCTCACGGCC
CGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCTGGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGACT
GCACTGTAGAGTAATAAGCCGTCGTGCACCCGGTAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAACTTTGTCAGAAGGCGCTGAGC
CGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTCGGGGTGCTCGATTGGATGGCGTCAAT
GGCATTGACGTCGGCATCAGTCGTGGTGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTA
TACGCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTTACAGCCGTCCGCAACGACGCGTGGTCCGTATAGACCACGAACG
GTTTGCTTCCGAGTAGATACACGCGGAACTCCGCGAGTGCGTACTTCATGGCAAGGAGTTCATTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCGG
CTGACGCGATTGGTAGTAGACGACACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGG
AATGGGCGATCTTGGTCGGCCACCGCCAAGGTTGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGCCCAAACCCACT
CGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAG
TTCCTTGACGTTCGACGGAGTCGGCCACTCATTGATCGCTCTGACCTTATCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGT
ATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGTAAGCAGCTTCCGGAGATGCACCATGTGCATCTCAA
CATCGCTCATCCCGTCCGCAGCTCGGCTGCCGACGGACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCT
GTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTC
TCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATCTTTTCGAGGTATCG
GCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGTATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTG
CGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGACTTTTGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACA
GTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTCCGCAGGAATCTCTTCCGGAAGTCGTCCGTGTACTCCCGTA
AGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAAAGTGTCCTCGTTCTCAGTGGT
GGTCTCCATGAAGAACTGTCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCA
CGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTTCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCAC
AGGTACGCGTCAAGACGTTCAACGTCTCAACGTCCGGCTTCTCAGCCTCCGTATGCCCGGCAGACATTCCTTGTAGCGTCTCGGTCCCAGGCCGAGACTT
GCGCAGCGACCTTCGTATGCTCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCT
TTAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGGACGACAGCATGCAA
GTTTCCCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTCCCGGAGCCGACACGCCAACTTCACCTTGACGCCTATTATTGGCGGA
GCCCTTCGTTACAAAGGGTGCGTCGACTCCCGGAGTCGACGCGAAATTTCGTCCAAGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCC
AACCGTTGGCGGAGACCCCCATTACGGAAGATACGTCGGCTCCCCGAGCCGACGAATCAATTTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTAC
ATCACCTTGGCTCTTATTATTGGCTAGACCTGATCCAATCAGATTCGCGTCAGACTCCACGGCTAAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTT
GAGGCCGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCT
GCTCTTGCGCGCGTGGTCGCGCGCGCCCAGGGCGCTCCGGGGCAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGT
AGCGGCAACAGGGCCATCGCTAACTGCTCCACTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGTCGTGCAAACCAC
GGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTTGGCAAACTCTTGTTCTGCATACGTGAAGCGCACGCGTACCATGC
GTTTCTCGGTCTTCACGATGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAG
TCGAACAAAGTTCTTCGACGCGCTAGAATCTACCAAAGCCCGGAGAGAGCCGCTTGCTTTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCA
TCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCC
CCGCGCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGAGGCCGTGCACTCCCGA
GCAAAGTGACCGATTCTACCGCATCGGTAGCATCGCACATTCTTTCCTTGCGACTGCTGGGGTCCAGTAGTTGCAGCACTCGAGAGGTCCATGGGTTCTG
GGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCCAGAGTAAT
TGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCG
ATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGTCCTGCTGCAGGTCGAGGAACTCCGCCCTCG
ACCGGAACTCGTTTTGCGGGGGCTCAAACGCTTGTCTGAGCTCCTCCTTGAAACCCTCGTACGCGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATA
CGCCCAACTTCTTGCACGTCCGCCAAGATATGACATGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCG
ACAAGCCAACGGAGGAGATGCTCGCCCTCTCTTCCAAAGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGG
TAGACGAAGCAGCATCTCACTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCAGTCGGTGTTAGCGTACGCAGCATCGTAGCTACAGCCGC
CTTACCAATGACTGTTGACAGTCGTTTGAGAGCTTCCCACTCTGGGTCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAG
CTTTCCATGGACACCTCCTTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCATGTAGTCGGTCGTTGGACGGACTACAAAG
TGCTACCAGGTGTAATGGGCCTACTTTGGCTGACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATT
ATACTCGGGCCTCCGAGTATAGATTAATCTAAATAATCGATCCAAATAATGTTTTTGGGTTAAAATGTGAACTGCTATTTTTGTTTTATGTTTCTGACTT
CCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCA
GCCAATAGGAATCATAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGGAAGTCTTTCGA
ACCTCTAAC