Description :
From Genome Similarity Track
Location :
Scaffold_3:2144559- 2145955
Transcript NameFunction/comments
Physo_263679Hypothetical protein

Sequence
1396 bases(100 bases per row)
TGTAATGGGCCTACTTTGGCTGACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CTCCGAGTATAGATTAATCTAAATAATCGATCCAAATAATGTTTTTGGGTTAAAATGTGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATG
TAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGA
ATCATAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGGAAGTCTTTCGAACCTCTAACA
GACGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCAC
GTCAATCAGGAAATTGACCATTCGTCAATTCTTCATGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGCCGCCG
CAACAGAGGGTAACCTCTATGTTGCTCAGTACCATGAGCGCCAGCAGACAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGA
GATTGTCCTCGAAGGTTCCGCTTTAGTCAACGACGCCGTTGACTACGAGAGTGATGACGTAGAGATGGAAGAGGGCGAGGCCTCTTCCAACAAGCGCAAG
GAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGATTCGGACGCTTCAAGCTCGAAGCGTTCGCGCGGCG
AGAGCGAAACTCCGCTCTCCGCTGCTGGGGGCAATAAGCTCCCCGCGTGAGGTGGCGTCTTCAAATTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGT
GGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCTAATGAAATACCGCTGTACGTATGCAGCGGGATCCACGATGATGCTGT
GGCGGAGGAGCAGCACCTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGACCTCT
TCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGTGAGCGGGTTA
AGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGAGGGAGGCTGGAGCAGCTCCACAGATCCTCTGTGGACGCTGGTATTCCATACGCTGTGC