Description :
From Genome Similarity Track
Location :
Scaffold_1302:2144- 5554
Transcript NameFunction/comments
g18012.t1hypothetical protein

Sequence
3410 bases(100 bases per row)
CGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATACGGAAGCAGAAGAGGATACT
GAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTC
GATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTC
GTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGAT
CCAAGTCAGCAAAAATTCCTCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGG
GAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGATTGACGTCCTGGAAG
GATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGATACAGTTGCAACA
ATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTC
ACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCA
CGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTA
CACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGCTCCTGC
GTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTGGTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCT
CCTGGTTTACTATCCGTTCCTCGGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCCGGGCATGTTGCTCTTGGTTTACCATGCGTTCTTCAGCGCGCTC
CTCCTGTGTAAGCTGAGAACGGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTTGCGCTTCAGCACGCTCCTCCTGTGTGAGCTGTGATCGGCGCTGGGCA
TGTTGCTCTTGGTTTACCAACCGTTCTTCGGCACGCTCCTCCTGCGTGAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTCGCGCTTCAG
CACGCTCCTCCTGCGTAAACTGAACCCGGCGGTCCGCGTGTTGCTCCCGGTCTGTCCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGCGCG
AGAAGCACTGTTGCGTTCACGCTCCGAGGCGTGGACCTCTTCGTTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGTTTCGTTCTCGTACGTCCTGA
AGCTGCTCGGCACGGAGCTGGGCTCGCCGGGCTAGCTTTCGCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTCGGTCATGTTACTTCGTCTGG
AACGCGCTCGCTGCGCCTCCCTCATCCGACGTGGATTTGCTTGTGGGTCAGTCGCCCTCTGCACTGGAGCACCTGCAGAGAGCTGGCTAGTCGCCCCTTG
TCCAACGACCGTCGGCACAGGAGGGGCGGTTTCACCCGTTGCAACTGTGACGACGTCCCCTCCACCTGCGGCCGCCTCTTGTAGACTCAGTTGTTCCATC
TGCTCCATTGCCACCCGAAACCGCCTTTGAGCCGCGCGGCGGCGCCCCAACCGTCGCCTCTTAGACGCCGGAGACTCATATCCTTGTGGTGACGCGTTGG
CATCGAGGGCCTGGGTATGGCGCTGGTCCAGCTCCTGACGCCGCTCATCACTAACAAAAGAGACCACTGAGCAAGGGACACTTGACAACAACCAACAAAC
AGCCGTACCGCTCCCGCTTGCTGCCGACATTCACCATGGTGCTGTCCGCAACAACTGCAACAGCAAATGCAGCGTTAGTGGACTTCCCAATAAATGCGCA
CGTGCATTGGAAAACAACCACCCAAAACTGCAGTCGTTAGTAAAAGGACGGCCGGTACTTCGCAATTCGCAAGGAGACGCCTTCTGGAGACACACCTGCA
GGATACCCGTGTAGCACCGCCAGTCTTGCACAGTCCTCGCCACGAACCCGAGTCCTGCACGGCTGTAAAACACCTCATTAGCCTTGCCGCGTTTGCTTTC
GTTTGTTTCTGGTCCCTCACATCCACCGTTATCCCTTTAAAGCACCCCCGCATTGGTGCTGCGTCTCAATACCTTTGGAGACACAGCTGCGGGTTCGAGG
TGCTGAAGCGCGACTCGGTACCTCAATTTTTTTTTTCTTTTCTTTTAGTTGCTTCCTTTGGCAACGGAGGTCTACCGGTCGCGCTCAATGCCACTGAGCT
TTATCAGCTCAGGCAATTAACCGTTTTGGTTGTAAAGGGACACGTGTCAGCTTTTTGGGAATCTTTTTTAATAATTTTTTTAGCAGCAAGGCATCATAGG
CATTAAAGGGCCGTACAAACCCCGAGTTTGAGCGCAGACTGCACCAAACCAACGGTTTTCCACCGGTACCACTGCAAATGGCCACCGTCGAGCGGTCCTC
ACTTGTCACAATAGTGCCGACTCGTCCTTTTGATTGGAAAGTGTCCGCCACAGCCGTAACTGCACAGAAACCCAAATAGCATGTTACCACACTACGGGCC
GGTCCCATTACACGGTGTCAAGCCCGGGGCTAGGATGGACGACCCGGCTAGGCCGGCTTTTATCGCCGTGTGTACCCATCCCAGTCCCCCGGATTGGTAT
GAGACTTCCCACTATGCCGGCGGGCATAAATGGGCGCCTCAGCACCGCGGCTCCGAAGAGCAGGTTGGATGGCGGACTGTCTTGGAACGCATTTCGGGCG
CCAGCTGCAATCTTTTTATCGGACCTCTAACCTGGAGTTATGCTTCCCGGGGGTGAAGGGAGCCCCCCAAAATAGCATGTTCACCAGAAAGCCCGAAAAT
ATGGGGTAACCGTCACGATTGCTTCGAGAGAGGTCGGCCTGGCTCGCTGGGCAGGGATGGGATCCTCTTGGGGGCTGGCTAGGCCGCATCAGTGTGGCAG
TCATAGGGTA