Description :
From Genome Similarity Track
Location :
Scaffold_75:214382- 219352
Sequence
4970 bases(100 bases per row)
TACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGATTCGTGGAACTAGACGATGCCATAAAGACTCGTCATATCGTCGATGAGGAAATGCAGATCGCAC
TTACTCAATCAAACTTGGCAGGGCGCGCAAAACATGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCC
TTTTCTAAGGCAAACTTTTGAGCCGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATT
CAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTGCGTTGTTCATGCAGGGTCTGACTGATGGTTCTGTTA
AAACCTACCTGTTCCTATCGGAGTTCAACACCCTAGAAGATTCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTCGAA
TTCCTATCGTCCGTCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAACACGAGGAGCGAGAGCTCTCGTGTTAACAACTATAAGAAA
TTGCAAATGCAATAGATGTCAGAAGACGGGGCATTATGCATATGAATCCATTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAGTAACCGCCAAGCG
GCCAAGCGAGGTCCAAGGCGTGGGTCCGACGTTGGTGCGAAGACGCAACAACATAACGGAAAGGCAAAAATGGTCAGGGTCAGTAGGTGTGGAGCACCCT
ACTGATCCAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGACGAAATTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCC
TCATTACCTTGAAACTCGAGGTGACACAAAACATGTCGCTCCGAGCCCTAGTCGAGCGTGGGGCGTCAAAAAACTTTATACGACGCCAGCTAGACAAAAG
AGAGCTGGAACATGTTGAACGAGAGATCCCTCCAACGAGAATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAAATTGTAGTGGGTATT
ACCTATACACTGAACAGAGTCCAATACAATGATGACTTCATCATATTAGACTCGGATGACAAATTTGATGTTATCCTTGGACTGCCGTGGCTCAGAAGGT
ACGAGCCACAAGTCAGCTGGCGTCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCCCACGAACATG
TGGGTTTACTACAAGCGAGTTCGGTGGCCTCGCGTGTGTTCATGTGCAGTCGTTAGTACGACTGCACATGGCCACGGAGTGGCTGATCGACACACAATGA
AGCCAGATTCAGGCGACTGCATAAGATACAGGTCGCGCCAAAGGCCGACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGTCCTCCAAACGGACAA
CACCCAAGTGAAATGAACCTATTGCCAATGATTGGCAGTACGATGATCTTAGTGCGATTGGAGAATCGCACGTGGAAGACCTGGCCACGGTAGCGCAACC
ACAGCCAGAAGATAACGAGGGAGCAATTCCACCCGTGTCAGATGATGAGATATCCCAAGAGGCTAGTGAGGGAATAAGTCCCCACCCAACTGTGGAAATA
AGTTCCCAGGAGACAACTGGGACATTAAATGTCCTAGTCATTGACGGATCAAGCATAGGAACATACCAAATTGATCTGATCGCGCCTCCGACGACAACTT
CGGAGATCATTCAATTTCCCACGCTCGAACAGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGAATTGCGTACTCGTCGCGGAAGACGA
GTACGTAACCGATATTCGGTCGACAATGGTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGACGAGAAGACTCGA
ATTTTTTTGGGCGATACACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATGTGTTCCCAGAAACAGTGCCGTGCG
AGCTACCCAAGGGTAAGGGTACTCGTCACGAGATAGACCTAAAACCAGGGTCAAAGTACTGTGTCATGAATCAATGGCCATTGCCTCGTGAACAAGTACT
AGCGATTGATAGATTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTACCCACATAGCTCTCCGACCTTTTGTGTCCGAAAGGCCACA
TGAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGACTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATAATATGT
CAAGGAGTACCATCTTTTCATCGATGGATTTGATGGACGGGTTCTATCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGCAGTGAGCACCCCAAG
CGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGCAATGCCCCTGCTACCTTTTACAGTTGTGTTACGAATCTTTTAAGATCTGTGCGAGAA
TTCGCACCCAGCTATTTCTATGACGTGTTCTTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACCGACTCCACGTCCGGAAAGTTCTTA
CACTGATGCGTGAGCATAAGTTGTATGCCAATCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCGTCGTGGGTAAGCACGGCGT
CCGGCCAGATCCGGAAAAGATCAAGGCGATCACTGACTTGCCGGTGCCTACTGACATAAAAGGACTTCGAAAGTTCCTTGGTCTAGCGGAGTATTTGAAC
AAATACTCGCACAATTACGCCGAGTTGACAGTTCATCGCTCTCGTTTATTGAAAAAGAACGAGAAGTGGACATGGAGTGCTGATTGCCAGAGCTCTTTCG
AAGGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCAATTGCAGACCAAGACATACCATTTCATGTGGTCTGCAATGCAAGCGTTTTTGCCATCGG
ATGTGCACTAATGCAGTATGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCAGCTGAACGTAACAACTCAGTACATGAC
AAGGAACTCCTTGCCATGAAGTATGCTTTGTCAAAATTCAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTATACACGGACCATGCGTTCTTATGCA
CGGTCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTAGCGGAGTGTAACTTCTCCGTGGAATATAAACCAGGAAGACTGAA
TGTCGTCGCTGATGCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACGTCGAGTGTCCTG
TCGTCAATATTACTAGAAGACATACGCAAGGCGTACGATCCGTCGATGGTGCGTTTGATGGAACATCTTTCGCAACCATCCCGTCAATCCCTTCAAAGAT
TTCCCCCAGTATATTGATCCTCCACGGATAGATATGCAGTCCACAATGTCTTACTGAAGTATACAGCCGTTGCCAGCGACACACCTCGTGTCGTCGTACC
GGACCATGGTGACCTGCGACTGCGCATCATGTATGAGTGCCACGATGCATCTAGTGGTGGCCATCGTGGTCGAGAGAAGACATATCTCACAGTTAATCGC
GACTTTCACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAATTCAGGTCCTTCACTTCGTGCTCCGT
TGCAACCCTTGCCCGTTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTTGATTCCCCCAGACCCACACAAGAATAAAGGTATTCTTGTG
TTCGTTGATAGATTCAGTAAAATGGTACATCTGGTCGCTGTAAACCTGAATCTATCAATGCATAGGCATGTGCTCGTGTTTTTATTGACACGATCTGTCG
TCTTCATGGGTTGCCTCGTGAACTCGTTTCTGATCGAGACCCACGATTCGCTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAG
ATGTCGATCTGACCATCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCATTCTTGAGGAAATCTATCGGGATTATGTCCATTCGTTTACGAATTGG
AGCGAGTTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATAAACCGTTCTTCGTGAATGTCTTGCGCCACCCACGCC
TACACACCTTCTTAAAGTGTAACTCTAGTTTGAGAGGGGGAGGAAATCATTCGAGCGAACGCTAACTCGGCTCTCACTCATCACGTACTGACCACGAGGT
CACTACGTGTGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGAAAAGTAAGAGCGAGGGTGATCTTACTACCCAAGTCACTGATCTTGCCACA
GTGCGCTCCAAGCGCACTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTTGTCCGTTTCGTGCAAGGATCCATTGCAG
AAGCAGTGGACTGACAAAAGAAAAACGCATACAAGAATGGAAGGGCAAATGTTCTTTCATAAAATGAAGGTTACCTAGTCCTACTATCTACGGTAAACTT
ACCTCGACACATAGTGACTAACGTGGGTAGTAACTTGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCTTAGGCAACGCATACACGATT
GAGCTGCCACGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGGCCGTACTGCCAGTACG