Description :
From Genome Similarity Track
Location :
Scaffold_26:214359- 215971
Transcript NameFunction/comments
Physo_133441reverse transcriptase

Sequence
1612 bases(100 bases per row)
GCGACGCATCAAAGTGCACCAGGACAAAGATGGTCACCTGCTGCAACTCAAGGATTTCCTGAAAGGAGACACGACGAAGCTGTCGCACGCTCAAGCCAGG
AAACTCGCGAAGGTCGCTGATGATTTCGTTTTGGATTCCAGAGAAGTCCTGTACCGCTTGAGTCGGTCTACCAGAGATCGACCCCGAGATATGGTTGACG
AACTCAGACTCGTGGTGCCGAAAGCTCTGCGACCGGATATCCTGCATTACGCTCACGAAGATTTTCAGGGTGGGCACTAGGGGATCACGAGGACGGACGA
GAAGCTGCGCTCTGAGCTCTACTGGCACGGCATGTACGCCGATGTGGAAGTTTTCGTCAAAGAGTGTGTGGATTGCGCCAGCGGCAAGGGGCGCCCTCAG
AATCCAGGGCCTTCCCCTGGGAACATCGAACCGAGGCGCCCTTTTGAAGTTGTGTCTATGGATTTCGCGACACACTTGCCTAAGTCGGACCGTGGGAACA
CGTTCCTGCTGCTTTTTCAGGATGCGTTCTCAGGATTCGTCATGTGTAAACCCATGAGTTCCACCACGGCGCAAGATGTCACTGAAGTGTACGAAGAGCA
GGTCCTCAGGAGATTCGGCGCGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCATGCGCTTCCGTGAACTTTTGGGTAGC
AAGCAGCGAGCCACTCTGGCGTATCGCCCCCAGGCGAACGGACAACAGGAGCGGTCGGTGCAGACTGTCGTGCGCAGCATTCGAGCGTACATTGCTGAGG
CGGACCAGAGTGACTGGGACGACCATGCTGAGCGCCTGGTGTTTGCCCTGAATACATCGTTCGATGCCACTCGCCTGGACACTCCGTTTTTTCTGGTGCA
CGGCTGGGACGCACACGGCACGGTGTCTGCAATGTTAGGACCCAGGCCCTCGAGTATCCAGGAGCACACTGCGTACGACTGGCGCAGGAAGCTACAGCGT
GACTATAGTTATGCACAAGCTTGCGCCGAGGATCTTCAGAAGAAGGCCAAGCGCGCGCGCTCTGCCGAACAAACCAGGAAGTGGAGAGAGCTGTCCGAAC
GACTGAAGGCAGGATTCGCAGCCGGTGATGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAACTGGCTCACATGTGGCATGGCTC
CTTCAGAATTCAGGAAATCCATGACAACTTCCGCGTGAAACTCAGGGTCAAGAACACAGGATATCGCGTGAATCCCTGGGTACACGTGAGCCGTTTGAAA
CCCAGAGCACTATTCTCGAAGCGGCCCACTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTATTGCCTGAAGACAGTTGGGAGCCCA
ACGCTGCGAACGATGAGTACGAAGTTGAGCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGACGAATTCGTGAGTACCTTGTGAAGTG
GAAGGGGTATGATGAGACCGAGTGGCTGCCTGTGTCGAAGCTCAACTGTGGTGCCCTGCTCTACGAATTCAATCAAGACGCAAGAGCGCGGGCCCGTTTC
CAGGCCATGCAG