Description :
From Genome Similarity Track
Location :
Scaffold_74:214322- 216194
Transcript NameFunction/comments
g4547.t1AEB21380.1 protein kinase 157785 isoform 1 [Phytophthora sojae

Sequence
1872 bases(100 bases per row)
ATAAAGCATGAGCGATTTGAGCGTAAACGACGGCGATTGAGCGCGCAATTTCGAGGGAGGGAGGCTGCAGCTGGAGAACGTACCGGAAGACGTTGCCGCA
CACGGTGATGGTCTGCCCGTTGGCGCTGCTCATACTGCTAGAACCGCGTCTCGGAGTGATTCCCCGTGTCTCTCCGATCGGGTCGCCTTCTCTCAAAATT
ATTCGCTTTGTTGGGTTTGGAGGTGCACACCGACCCCGCATGCAATATAAAAGGATTATGGTGTACAGAACCTCGTTGAAGTTGACATAGCTACAACGGA
CATGGCTACACTGTTTCCCCTCCTGCAAGCGGGACTTCTTCTTCTTCCTCGTCTTCGTCTGCTTCGTCTTGTTGATTGTCATTCTTGCCGACGCCGTATT
CGTCCTCCCCGTCGAGGTCATCGTCCTGCTCCCCACCGCCTTCTTCGTCGTCGCTGCCGTCGTAGAGCTGCTCCTGCGTGGCCGCGATCTTCTGGCGCTG
ATCCTCCTCGAGTTTGCGTGCCTCTTCCTGCGCATCTTGAAGCACACGGTCGCGGCTCTCTTGCTCCTGCTGCTGTTTGGCGCGCTTGGCTTCGTCCTTC
TTGTGGGTCCACTGATCCAGCTTGTCCTGCCGCATACGCGCCGTCTTCTCGCTCACGAAGAACGCGACGGTCGCGATGAACACGATCCAGAAGGCCGCCA
CCTCGTACTGCGAGAAGATGTAGAGCGTGGGCGACATGGACAGACAGGACTCGAAGCCCGAGCTCGTGGCCGTGACCGCCTGCAGCGTGCCGTAGAGCCC
CCACCACACGACGCACAGGAGCCCGTACACAAGGTAGAAGACCCGCACGGTGCGCAGGCTCCTGATCGGCCACGGCCCCATCCAGCAGTACGTGTAGAAG
ATGACAAGCACGTGGCTCAGCACCACCGCGCCCTGCAAGAACCCTGCAAGCCGCGACAAGCACAACGGACATCAGCCACCCACCACACGCGCCTCAAACA
GCGTTCGTCCTCCTCTGCGGGACGGCATTACCGCGCAGCTGCAGGAGCTACAGTACTGATGCAAACGCACTCATGAGGTCGGCGTTGCAGTCGTTGGTGG
CCACGTTGATGATGACACCGCCGAAGACGATGGTCGTGAGCGCGAGGCACACGGGCACGAGCGGGAAGAGCAGCAGGATCCGAGCCCAGTACTTGGTCTT
CTCGCGCTCCATCGCGATCCGCGTCGCCAGGTCATACTGCACCTACACAGCAGTCCGCAGCCAGCCAGCGCACGTCAGTGAGTCTACCTATGTGCATTGT
ATCCTGCCGGCTACGTCATGCCACGCGTGCGTCTGCCGTAATGGAGAGACAACATGCACGCACCGACCGGCGGCTTCTTCTTGCGGCGCGCGGCGAAGGA
CGTGGTGCGCTTCGGGTGCAACTCCACCGTGTTGGGCGAGTCGCCCTCTAGCTCGTCGGCCATTCTCCGTTCGGACTGCGCACAGGAAGCGTCGTTCGTC
GACTGCCGCCTCACACGCGATCTTGAAGCGACGCCCGCATCGATCTGCGATGATGTTTTGCTGTTGCAAATCGCGCCTGGCTCGCCTATTGTTGACCTGT
GGCCGTTTTGCTTGGCAACGACACAGGACCGCGTAGCCTGGTGTCACGCTCGGTGGCCGAGCTAATTGGCCATTGGGCAGAGGCACCGCGGCGACGGAGC
GATTTGCACAGGCCGCGTGCTGGCGCGTGTGCGCGCATCCATGCGAACCTTCTCTCTCCCCGAGAACGGTGTTACATTTGCTCGTCTGGCAGGAGGTCGC
CATCTTGGGCCACCTGGGCGATAGCCCCGCCCGAGGCCGCATGGCCATGACATCACCTCGGAGGCGCAGTGA