Description :
From Genome Similarity Track
Location :
Scaffold_64:214311- 232403
Transcript NameFunction/comments
Phyci_230509Hypothetical protein
Phyci_29394hypothetical protein
Phyci_230339notchless family protein
Phyci_94193Hypothetical protein
Phyci_82053Hypothetical protein
Phyci_512656Hypothetical protein
Phyci_512787Hypothetical protein
Phyci_230394conserved hypothetical protein

Sequence
18092 bases(100 bases per row)
CTGCTACCTGGGCTATCGTCTACAACCAGATTCAGCGGATCCAGCCTGGTATTTTTCACCAGGCCATCAGAGCCGTTAGTCACCAATGGCACAGAGGAGA
CCTTTAACTTCCCCGCGATAGTCGGCGATCCTGGCGCGGTCTCTAACTTTGCTCGGAGGCGTCCGATCTCCGTATGGCACTCATCAATTTCAGCCTCCAG
TTCCTGGAAACGAAGAAATTTGCTACCATGTACATGAGTGGAAGACGTGCAAATGAATTTTCCAATGCCGCCTACCTGCTATATCGTAACCGGTCGAGCT
CTCGCCTCCGTTCTTCTGCTAGCGCTTCAGCAGTTGCAGCCTATCTAACCAGTGCGAATACGGTGTGAATCCTTGAGAGGCAGATATTAATTTACTCAGC
TGTCTCTTACCCTCTGCACACACTCTGATACAAGGCGATCGATTAGCTCCTGCTTTCGAGTTTTCGTGGTCTTGGCATCTTGCGGCGATCTCAGGATAGC
AAACGCAGCCTGAAGCTAATTTTCACGAAATTGCACGAACACAACCAGTGAGAAGCTGTATAATCGCCAGTCACGTAGCGCAATAAGGGAAGAACAAACT
CGTGTCATACGTCCTTGTCTTTCTTTCGCAGCGTCTCCTGCAGACGGCGAGACGCAGTCTTGAGCTGAATCACCAGTGCGTCCTAACTCATGCGCCATCA
CCCATACTCGTTCAGTCTTCACCATTATGTAGCACACACACAGTGCTTCTCCACCAAGCTGCTCGAACCTTCTCCGTCAATTGCCTCTTCACCAGCGCGA
GCTCCTGCTTTGTGTTTTCCCACTCGCGCCATCCATCGTCCAGCTAACAGCAAGCAACAATCAGCTCACGAACACCGATTTCTACTGCAAAGGGTCTAAG
ATTTTATTCTGCCGTACCTCAATGTGCTGGTACGGCGTCACCTGCGGCTGACTGGCGCTGCCCCCTCGCCTGCTCATTAACCGCCTCGCCATCGCGACTG
TGATTCACTTGTGAATGCCCTACGTCGTTTCGCGGCCCGGTGTAGCCATCTCGGAACGTGGCGAAACGTCGCGATCATCTGGCTATTGGTATCACTGCAC
AGCAGACGAGAATGGGCGAGGCACCGAGCTGGCAGCACATGTGGGGCGCCAAGGTAAAAATGCCGTGCGACATGGAGGACGACGTGCTGGAGGACGCCAT
CAAGCACGTCACGTCGCGGCTGGCCAAGTTCGACACGGAGGAGTGGGAGAAGAACGGTCTGGCGGTGCGTGAGGCGGCAGCTTCCATCAAGCATTTATCT
GATACGCAGCCGCCTGACGCTGTATGATGTTGTGTACGCTGCTGCGTTGCCAGGTGTGCGAGGAGATCAAAGCCCATCTGGATGAGGCGTGGGACCCGCA
CTGGGTGGTGTGCATCGGCCGCAACTTTGGCTCGTTCGTGACCCACGTGACGAGAAACTTCGTCTTCTTCTACTACAACGAGAAAGCGGTGATGATATAC
AAGGCAGGGTAGGCGTACGTACTGGCGCGACCCGTAGCTGGAGCCTTGGAAGTACACGTAATTTTTTTTTTTCGAGTGGTTGCAACCTTTGGAGTACGTA
GCAATAGATACGACCATCGACGTTGCAATGTTGTGTTACATCTTTGCCAGCGCCCCCGTTGTATGGAGGTGATGGCGGCCAAAGTGTAAGGGTATCCATG
TCTCTTGAAGGCACGAAATGCTACAGCAGAGAGTGCACTTCAACTTCTGCTATTTTCGACCAATCACCGCGCGACGGCTGCAGCCCAACAGTTTTGACAC
ACAGAGCGCCATTCGCAGCCATGGCCACGCACGTCGCCAAGAAGATGAAGCTGGAGCACGAGCCCGTGGCCGACGCGGCCATGAAGGCGGAGGACCCCAA
CGCCAGCGACAGCGAAGAGGAGGAGGAGGGCGCTACGTCCGCCATCGCCCAGTTCCAGAGCGAGGACGTGAGTGCCAGGAGAAGTTTGTGTCAATGCGGA
GAGGTCCATGGACGCTAATTCCATTGCTGGTGTGGCTGTGGCTGTTGCTGTGGTGTAGGGCACCAATGTGGGCCCGCAACTGGAGATCCCCATGAGCTCC
AACGTGCGCCAGATGGAGGAGCTGGTCAACGAGTTGCTGCAGAACGGCAAAAACCGCGTGCCTTACTCGCTGTTCATCGGCGAGACGGAGGTCACCACGT
CGCTCAAGGCCACGGTGGAGGAGCTGGTAGGTTGCTGCAAGGCTGCTACTGTCTGCACATAAGTTGCTGACCTGTGCCGTGTATTTTGGTGCAGAAATTG
TCGACGGAGACGGCGCTGACCATCACGTTCCAGCCGCTGGCGGCGTTCCGCGTGCGTCCCGTGACGCGCTGCAGTGACACGCTGCAGGGCCACTCGGAGG
CGATTCTGCACGTGAGCTTCAGCCCGGACGGAAAGAGGCTGGCGAGCGGCGGAGGCGACGCCACCGTGCGCTTCTGGGACACCAACACGTGCATGCCCAA
GCACACTGGACGCGGACACAAGCACCACGTGCTGTGTACGGCGTGGTCTCCAGATGGAACGCGCTTCGCCTCGGCCGACCGCAACGGCGAGATTCGGCTG
TGGGACCCGCTGACTGGCAAGCAGATCGGCCAGCCCATGAAAGGCCACAAGCAGTGGGTCAACTCGCTGACGTGGGAGCCGATGCACCGCAATGCCACGT
GCGAGCGCTTTGCCAGCTCTTCGAAGGATGGATCGATCAAGGTGTGGAATGCTCGTACGGGACGCTCTATTGCCTCGCTGTCGGGCCACACGGACTCGGT
CGAATGCATCAAGTGGGGAGGCGAAGGCCTGCTGTATAGTGCGTCTCGCGACCGTACCATTAAGGTGTGGGCGATGGAGGGCGAGCACGTCGGCAAGCTC
GTGCGCACGCTGATCGGACACGGCCACCGCATCAACACGCTGGCGCTGAACGTGGACTACGTCTGCCGGTCGGGACCGTTCAGCCACAACACCAAGAGCT
TCGCGTCGCGCGAGGAGATGCAGCAGGCAGCGCTGAAGCGGTACCAGGAGGTGCGCAAGGGCCAGCCCGAGCGACTGGTGTCAGGCTCGGACGACTTCAC
ACTGTTCTTCTGGGAGCCATCGGAGAGCAAGAAGCCGCTGGCGCGCCTCACGGGCCACCAGCAGCCCGTGAACCACCTGTGCTTCTCGCCGGACGGACGC
TACTTCGCCAGCGCGAGTTTCGACAAGAAGGTGAAGATCTGGAACGGCCAGAACGGCAAGTTCGTCGCCACGCTCACGGGCCATGTCGGCGCGGTGTACC
AGGTGTGCTGGTCCAGCGACTCGCGCCTGATCGTGACGGCCAGCAAGGACTCGACTGTCAAGGTCTGGGAGCTGAGCGAGCCCAAAAACGCCAAGACGAC
GCTGTCGGGCCACGCCGACGAGGTGTACGCGCTGGACTGGAGCCCCAACGGCGACATGGTGGCGTCGGGCAGCAAGGACCGCACCATCAAGATGTAGGTG
CCACGCTGCGATGATGTTGTTGCTGTTGCCGTTGAAGTTGTACCGGTCACTAACTCCCTCGTTTCTGTGTCATCGTTGTCAATCCAGCTGGAAGCACTAA
ACCCGCACTAATTTGCAATAGACTGTCATCCACAAACCGTACCCTGACACAACTAATACACCTTCCTCCCTTCTCCATACAAAACTCCTACTCTCATCCC
TTTCCAACACAATAACCCTGGTGTACCTCCCCGGACCAGCCGTTGCAAATCCACATGCCACTGCGTCCTCGCTGCATTGGTGGCGCCAATCCCCGCCATA
CTCAAGTCAAGTGAAAATTCAGTTCCCGCCATCTCGCGCCTCACTTCCGCTTTAGCGCGCGGCCAGCACAGCTCCCCACCCGCCCACGGTACCGCTACCT
TCCCCGCCATGAAGCGCGCGAGAGACGAGAGCTCGACGGACTGCGACGCGCTGGGCATGACGCCGCCCCCGTCGTCTCTCTGGGCCTCCATGTCGCCCTG
GAAGCCGCCGCAGGCCTCCAAAGCCAAGCGCTGCCGTGACCGCTCCGTGCCCGTCGGTGCGTGGCGCTAATTGCCCTCCGCCCGCCTTGTTTTAGCGCCT
AAAACTGACCTTTGCCGCGTGGCTTTAGACGCGCTGAGCCGCATGATGTCGGCCGCCGTGACGAACGCGCGCCTCAAGAAGCACAGCAGCATCGGCAAGC
TCTTCTTCGGGCGCGCCAAGGACCAGGACGCCGGCATGGACGTGGACGCCTGCTGCGCCGTGTGCGAGAGCGCCAAGCGCCTGTTCGCCGCCAAGCAGAT
GCAGCGCTGCTCGCACTGCGAGCGCCAAATGGGCGACTGCTGCCGCCGCGAGTGCGACGCGTGCGCGCAGGTCTTCTGCTCGCTGTGCTCGACGCTCAAC
TGCGACGAGCAGTTCGACCGCGTCTTCTGTCTGTCGTGCAACCAGGACCAGAGCAGGTAGAGAGAGAGAGAGAGTGGATGGAGGCTGCCGAGCCTCGAGC
TGGTGTTTTAATTAGTAATTCTAAAGTGCATGTTGGTAGCTTGTACGTACGTGGATGCATCGGTAGACAGTCAAGGGAGAGAAGGGTCTAACTGAACATG
CCTTCTCCTGGTGCGTCGTACAGGAAGCTGCGGACGATCTCGTACGACGCCGCAGGCTGGTCGTGAGGAACCATCTACAGGCAAACAGAGAGAGCGAGAG
CAGCAGGTCGGGTGGGTTAGTTGGGGGGAGTGTGACAGGGACAGCAGGACGTACGTGGCCTGCGCCGTAGACTTTCATGAAGCTCAGTCCGTGCGAGGTG
CGGACGCGTCCGATGGCGTGGCCCTGGAAGAAGACGTCGTCGAAGTCGGCGGACGTGAAGGCTTGCTGGTATTCCCACGCGAGAGCGCGCGTCCACGAGT
CCTGCGACATCCAGTTGACCACCGTGTCAGCGTCGCCGCCGTAGACCAACACGCGCACTCCGTGCGCGAGCACCCGAGCCACGTTGTACTCGCTTTCTTC
GAGTCTGTCCAGCGGCGCCAATTTCTCGGCTGCCCCGGACGAACATACTTTCCAGTTGTGCGAAGCTTCGTCGAAGTAGGCCTTCGTGGCGTCGGTGTTC
ACGAAGTCTTGCAGACGCGTAAGGCGGTAGCACAGGTGGAGCTCGTCGTCTTTGTGACAGTCACGACGGATATCGTACACGTTTCGACCGAGTTCTAGGA
CCGATGAAGCAGCTTTGGATGCGAACTCGACGAACCTTTGGACAGCCTCAGCGGAACCAACACCGGCACCACCAGGAGACGAACGGCGCAGATTTCCCTC
TCTCCTGCAGTTCGCGATGGCGGATGTGAACAGTTCCGACGCATGCTGGAGGTCGTCTTCGTTCGATCCAATGAGGTGGTACCCGTAGTTGTAGGATTTC
AAAAACGGAATGGTCGACTCGACCCAAGCCGTTGTCGACACCACCCCGTTGCCGATTGCGATGCCTTTCAACGTGGGGAGTGAGCTGTCGTCGTCAAACA
ACCTGGACGCCAAGTCCGGCACGTAGTGTCCCGCATAGCTTTCACCGAACACGTAGAAGTCTTGTGTTTTAAGCGTTGGGTGTTGCAGGTAAAATTGACG
GAGGAACTCGCGCATCCTGTCCGCTGCACCCCCGAGCGACCAAGGTTCCGTGACCCCCTTCTCCGCGTCACTGTATCCGGTGCCCTCGGGCTGGTCAAGG
TAGATAACGTGAGCGAGACCTGTCCATGAGTACGGATTGAACGAGAGTTTGTCGGCCTCGTCGTCGAACATGCAAGGCCCATTCTCAAACAGCAGTGCGA
CCAACCCAGAGCACCCTGGACCGCCGGAGAGCCACAGCATCACGGGGACATCATCTCTGATGGAGGACGATTCGTAGAACACGTAGTAGAGACTGTTAAG
TGTTCCGGTTTCCTTGGCAAGGTTCTCTCCACACAACGACATCGACGACGGAAACTCGTGAGCAAGGTCACTCGCTTGGGCGAACGCGAGATCGCCTCCG
GAGATCGTGCTACATCGCGCAATTAGCGCCACCAGGAGCAACCACCAAGCGAGAAGCTGCATTTCGGATGGCAGATTGCGAGTGCAGGAATCCTGACAGG
ATCCCCGTGACCGCTCACGTGCGACCTTTGCTTTCGAATCTTCGGTGAAGATTGCGACTAGCGGAACGGACAGCGATGCAGGCGGCCTGGAAACCGTGAA
GCAGTTGAGAGAATGAAAGCCGGGGTTAGGAATAGCTCGTGAGCCAAGTAAACGTGTCAAATGATCGCACGACAAAACATCTCAGCGTGTGTAGAGCTAC
CGGTGGGTTCTACTAGCCGGACGATACTGACGCGATCCATCCTTCCCACAAGATGCCATGGGCTTAAAAGAAGATGGAGTCCATGCTGGCGCAGAGAGGG
TCGTAGCTGGCGACGAGAACTTCCGGAGCAGGAACTTCTGTGAAGATTTCTGGTTGACTTTGCTTGGCCGGTTGGAGGCCGTCGAGTTGACCGGAGTTGC
TCCGTGGAGCTGCAGGCGCTCCGAATTTTGAGGGCCTGAACGCTGTGGAAGGAACCTGCAGTACTCAACTCGTTAGTTTTGCTCGATCGACAGCAGATAC
GTACCCCAACAACTGACCTGGCCGATTCGGTGCCCAGAACTGGCAACACTTGGCCAGTATCGTGACTGCGTAGTTCCTGACATGTCAGCATTACAACTTG
CTTTCACGGGCTGGACAGACTTGCTTACAGCACTTTGCGCTGCTGCAATTGGTGGCTCCGAATTTTCGCCGCGTTTTGCAGTGGCTGTCGCCTGTGTCTT
GTCTCGCCAGATTCCATTGAGTCGGAACCGATCCAACGACCCAAGGCTGGTGCTTTGCTGGCTTCTTCCTGGTGCTTCCTTCACCTTCTTTCGCTGCCGA
CGATTTGGGGCTCCTTCGTTTTGGCGCTTCGCCCGTGGGCGGGCTTCATTCCTGCGACCAACAGCTTTCCTTTTGCCGCTGCGACTACTGCTAGCACTGC
TAGCAGTAGTCTCGATCTGTAGCAGCTTGGTGTGCTCTCTTGACGCACTCTTCCCCTGTGGCTGTGGTGCTGGAGCTGGCGTTGCCGCTAAAGTCTTCAG
TATGTCTTGATGTTTGCTTCCAGTCGGCTTGAGGCCGTTTGCGGCGAGCTCCTCTGTCGACTGAGGGTGCTTGACTTGGCGAAGGTAGCGATCCATCCGC
TGCTGCTTCGCGTTTGTCTGGTGACTCGTCAGCGTCTTGATGTACCGGAGGATGCTGCTGTCTCCCGAGTTGTCGTCCGAAGCTGCATAACCCCCCGCAT
CTCGCCGATCTGGGGTCGTAACAGAGCGCTGCAGCACCGCATTCTGCTGCCAATTCATCTCGACCGGCTAGATGCAGCCGCGACGTGTGGTGCTAGCATA
ACGAACAGTTAACTCGGTGAGGAATCGTCCTCTACCATGCGCCTACCTTGCTCAGGTCGTGCGTGCACTCAGGAATGCGGAATGCGGAGTGATGGTCTCA
CTTCAACTTGTATTATTGTCAATGTTAGTGTAAAATATAGCATTTTAGTGTAAAAGACAGAAGATAAAAAACGATGTTGCTCTTCAAGCTACATGTACAG
CAGCTATCTGTTGAACCATTTCTTACGGCCCTTGGACTTGTGGCGGCTGTATATGGCAGCAGCTCGGCGACCTCGTCGGGAGATGGTGAGCGATGTGAGC
GACGAGTTTGGCGCCGTGGAACTCGGCGGCTTCCACGAGTCCAGCAGGGAATATCGTCGCTCAGACGGCACGCCACTTGTCCCGCTTTGTCGACTCAAGT
ATGTCGACGTCTCCGAAGGAACTTCGCCTGTCGCTTGTGTGTGCCGTCGAGTCGATGGCGCTTGGGAGTAGTCGAGGTTGATGCTACTCATGGGGATGTC
GCCTACAGCTGAGACCAACCCGTTGATCTTCTTCACCTCGACGTCGTCTGGCCTCATCGGCAGACTTCCACGGCGCGGTCGCGTGGCGAAAATGTCTTCA
TCGTCCTCATGCTCGTCGTATTCAGCCGCTTTTTTCGAGTGATACTGGGAATCGACCGGCTCGTAATGAGCTCCCAGCGTTGAGTAGCGGACCGATGTTG
GAGATGGTAAGGGCGAGTGATGCGCGGCTTCGCCCTTGTACCGGAAACTACGGGGCGCAACGGCATCTCCAACTTCAACAGCACCGTCCGCGAAGTTGAT
GCTCTTCGGAGGTGCTCGGATAAACGTGGCGTCGATGTCAACTTCGCGCTCGTCAGGCATGGCTTTGATGTCGACGCGGATGGAAGGCTCTCGCTCGTGA
TCCACATCGAAGCTTTGAGTACTTGCTATCATAGCTGAGGGCCGTTCTCTCGCCTGATCCACATCGAAACTTTGCGTACTCAGAGTATCTGGGTTAGCCG
ATACAATGTTTGTTGTCGTGGTTCCCACGGGCTGCTTTGATTGCGGCTGTCCAGTCTTCGTTGAGTTACGAATTAGTGAAGGCCTGCTTTCCAACGTGAA
GTTGTGCCATCGACCCATGAAGCTTCGTGATATCTGCTTCAAATGGGTTTCCTTCGGTTCCTCAGCGTGAATAATCCTCAGGACACGGTTCACATTGGAC
AGGAGAGGTGCTTCGAGCTGCTCTTTGTTTTCTACTATTCCTTCCAAGAATGCGAGCATTTGCGGGTAGTATTTGAGATCTTTTAGCCAATACTCAGGCT
CATCCTTCGTCTCGCTTTCTGTAAGTGCCGCGTTGCGAGCTTCCAGCACACGACGGAGAACCTTGAGCAACGGCGGGATGTCCGGATGTTGCATAGTGAC
TCGACATATTAGCAGCTCCACAAAGTCTTTCGAGGTGATCTCCGGGAACTGCACCAAGCGCCGGGCGATTCGCAAAACGGAGCGGTACGGAAAACTTGTA
ATCAAGTGCTGATTGCAATAGCGCACTAGTTTCACAATCTGCTCTGGCATGCGATTATCAGCGATGCTCTCGTCGATATCAAGTGAAGCCCGCAAGATGT
GCGTAATCGCCATGGTGTACTTGTCGATCTCATCAGCTGTCTTCTTCAGGGTATCGGGGGGATTCTGTAGATCAAAGCCCATCAGAAGGTTGAGTTGAGT
TCTCCAAAGCTGGAAAAGGAGCTCCAGGTTGTAGGCTGGGTTAGTCAACTTTTCTGGATCTGGTCGTGACAAGAAGCGATCGATATATAGACCAGCCACA
AAGTTGTGTGGTAACGGAATAACATCAGTCTCGTCATCCAGTAGGACGGAATCTCGCTTTGCGATTGATCGCTCCATTCGATTTCGACAAATGATTTCGT
CGAGCTTCTTGCGCACTTCGGTTCGCCTGTGAGAGTTCCATATCAAATCACTTTTCTCGTGATTATCGTCGAAGAACCGTGTTGCCTTGTTTGGATCCAA
GTGAATTTGATACACTATCGGATACGGAAGAAAGCGACAGAGTCCGCTGTACATATTCTCTCGTAGATCTAGATCTTTCGTCAACAATGCGTATAATACT
TCGAACGCAGGCTCTCGTAGAGCTTCAGCTCGGAGAAATTGTTCGTGAAGAACATGCTGCCTAGATTGAAGAGCGATACCTAATATCTCGACCCAGAGTC
CGCTGATGTGAACGTACTCAGCGATCACGAGACAAGTATCACACAACTCAGCCAGACAGGACAAAGCATAGAACGCTTGCTCGTAGGCGAGGTGGTCTGT
GATCACCTGAAGGCACCATGTAAACTGACAGAAAGGTGCCAGCATACGCTCCAAATTGCACTCAAAACCACAGATTTTGTTAAGAATAAGTAGCGCGAGC
TCTTGGCGGTTCAGGTAGTCCACGTTACCGAATTCAGCCTCCATGTCGGTAGAAACAGCATCGGATGCGACCTTTGCTTTAAACCCATAGGTCGATAATG
ACCGACGAGATGATATAGACACAATCTTTGATCTGTCGTCACCGGTAAAAGGCAGCAGATATCTGCCAAGCGTTGCAACAGATATTGAAGCGTTCACAGG
ATCCACATCGTCAATGTGCTGCTCCAAGCATTCCACTATGGCGGGTCGAAAGGCGGGTAAATCACAAAGAAGACTTAAGCAGTCCAGAGCAGGTAGTGTA
TCCGAATAAATCGCGATGTTGGGGTCTCTGTTCTCGTTCAAAAATAAGAACAGTTCTGACACAAACTCAACGGCAGTGATCGGATACAAAATATCCTCCG
TAATTGTTTGTGAATTTTCCACTGATTTCTCCAGTAAAACCTGCAGATAGACTCCTCCAACAGACGGCTCAGAGCTTAGACATTCGTATGAGTAATTTGT
AACACTTTCCAAAATGGAAATTCCGTCGATGCTAGAGTCCATGTAAAATTCGTCCGTAAGTTTCTGCGAGAGTTCATGTCGCGTGTTTTCATTCCAAATG
CATGTAGGTTCGCATATATCAGACAACAAAATTGCACAGAAATCACGACCATCAGGCTTGGCGAGAAGCTCCAAGAAGTTTATTGGAAGGAGATTTGCCA
AGGCATCAAGCCCTGCTGATCGACGGTCACCATCCGGACCCAAAGCTAGTGAGCGGAGTACCCCAAATGCACTCTCTAACATTTCACGCTCTTGCTTTTC
CAGAGCAGTCGTACTTTCCTGTGTCGTATCAATTCCTGACGAACTCTCTGCGGACGCCAAAATCAAATAGAGACCTTTCCAAAACACTCGCGTAGAATGC
ATGATTTGCTCTTGCAGTTCAGGGCTTCTGCAAAGGGACGACGCGATTTCAAATGACATTTTCTGAATACGCCACGGTTGAATGTTCTCGAACGAAAGAA
TAACATCATCTAGCAATGAGTATACGCGCTGGGCGTATTTGAGCTTGCTCCCTCCGTTTTGAGATGGGAACTCCGTCGCAGTAAAAAACGAGGTGTTGTC
ATCGTCCCCAAAGGTGCTAAAATCAAAAGTCTTGGACGGCGGCACCTCGTTCGATGTACTATTATCTCCCTCCATAAGCGATTGTACTCCTTCTTCGGAT
GCGAGAATCAGCTTCAAGATGCAGAACATGCTCTCCTTCTCTTCCACGTCGTGACCTGATGCACACCTTTCTACTAAATCGAGAATCGTACCCCAGCTAT
CTTCGATTTTTACGACCAACGGACCATTTTGTGGTGCAACGGAGAGCAGTTGTTGCAGCACTTTTCTTGCAATACCTCGAAATTTGGATTCGCGTTCCGA
TCGAGAGGATAACACACGGATGAGCAGGTCAAGTGTTGAAGACTCAAATGAAAAGAACTGATAGCCAAACTTGTCCAGCAATTGCAACTGTGCCTTCAAA
ATCCGCTCGATAACTTCGTCTGACGTTCGTCCACCGCTAGCTTTGTTTTTATGCTCAAGTGCCGCAGAAAGCGAGTCAAACGCATGACGAACTGCCGCCA
CTTCAATATTTTGTTGGCACAGCTCCCGATAGCGTGATCGCAAGGCAGATGAAGAGTACGTTGCATCTTCACTCCAGCCGAAAAGCTTGTACGCGTCCGA
GTGATCCATATCGTCATCCATACCATCTGCTTGACGCCGTGCTAGATATCGCCACTTCTCTTCGATACTCTTCATCAAGAATACAGGATCATCTACCTCT
TCGGCCTCTGAACTCGACTGGTTGAATGTAGAAAGATAGAAGCCGCTCAAATAAACGTCCCCGGACAACTCTAGGTAAGATATGGGAGGAATGGGTGTGT
GGTTGTATCTTGCCGCCACGCTTGTTTTCAAGCTATCTTTCAACTCCAGCAGATGCTCATACATCATTTCTTGTAAATGTAGCCTCATTGGTGATGACCA
TAGCGCACGCTTGTCGTGCTTGCGACCACAATACACATCTGCAAACTGCTCTGGTGTTTCCGAGTCCAGAATACCGATGAGGGATTCAGGAAGAATGTCC
GTTAAATAACTCTGACCAGGGAATCGATCAGAGGATCTTTGAGAACGATGAATACGCTTCAGTAGCGCCGCCTCCGGAACGAAAGCAGGTACCTTGTCAG
TCCCTCTAGGATTCGCAGCCGTAGACAGAATAAAATAGAAGATTCCATATTGGTATAACTCTTGTACCTCTTCTTCGCTCAGAGACATCAGCATCTCACA
GACGTACCGTCGAACATTAGGATCATTCACCACGAGTAACTGGACCAGCAAGGCTAACGATGACGTATTAGCCACAATTGTGTTTACCAAGGCTGGCGGC
CACAGATTTGTGTTCCCAGCTGTTATGGAGTGTTGATCTTTGATCATGAAGTTTCGTAATGTCTTCAAGGCAAATGCTGCACAATTCGTGTCAATCGGCT
CGTCGGTTAGCTCCATCCAGCGCAACTCGGGAAATTCAAACATCGACTTCCAAATGTGATCATCGCTGTCATGGGCGGAGCAGCAACAAACATACAGAGC
GCCAATTTGCCGATGTCGAATAAACGGGTCAGCATCTAAGTACTCTTTCAGACCGTTCGCTGAAAACGGGCCTCTAACCACACTCCCTTCGTCTGTTTCT
CCAACAGCCTTTAACCTGATACTCCATTTTAAAGCAAACCTCGTCTCATTGTAGAGGGATAGTTCTGCTATCGGAACGGAGGAGGTTTCATCAACCTCCG
AAACGTTCAGGGAGTCCATCATCGGTATATCACCAGAATCGTTCATCACGCCACTAGTTACAGCCGCTGTCTGGCCTCGGTGCGACAACACGGACATGTA
CAGCAACACTTGGATGTGATTCTTTGTACACAGCTCGGAACAAGCGTCACCAGACAAACTTAACCCAGACATCAGCTCAACGATATCTTGGATCTCACTT
GCCAGGTATGAATTACGTAGAAGCTCGGTGAGGAATCGAGCGCGGTGCTTTGTAATTGGCCGAGCTTCAGGAAATACGTGGGCTAACTCGATCAAGATTT
TTAGCATGGAGTGACCATGTTGCTCGTTACCGGTTCCTCCATAAAATTGAGGAAGTCCATTGCTTCCACTGGCGGACCAATCGTTTGTTCCCGATAGCGG
GATATTGTTGAGGTGAAGATGCTCTAGCCAACACTGATACACCTCGTTAAAAAACTTCGCCGGGTCCTTAGCAATATCCATGCTCGCAAAAAAGAGGCTG
GTTGAGTTTTTAAGCTTTCCACGATGCGTTCCTGCTTCCATTGAGCGGGCTATTTGGGCAACTTCAGCCAACTGCAATGATCCATCGTTTATCCTTTCAG
TGATGACGCGCAGGTAAAAACGATCAACTTGAAGTTCTTGGGCAATGCTTTCGTACCTCACTGAAAATTGGGCGTGATTCCATTTAGGTTCACTGCTTCC
TTTTCGAGATACAATCAAGGATAACGAAGCTGCTCGATTAGTTTTGAACTGATCGAATTCGTTGATTGCCAACGTTAGAGCAGCTTTTAATTCTGCTCGT
GTCAGTTCGTTCCAAATCAGGTCAGGCAGCAAAAAGTCTTTTCCAACCATACTGGAAAGGAGAGCCATGTCTGTCGATGACTCACCAGGGTAATTCAAAC
ATGAAGCATCCTCCTTGACTCTAGCCTCTTTCACGGAGCCGCTAGCAAACAATGTTCCAATCTGGAGCTGCATGCGGCGGATGAACCATTCGGAACCGTC
AACTTGCTTTTGAAGCTGAAGCCGGGTTTTCCGCCGTACAGACTCTGTCTGCCGAGCCCGCTGTTTTTTTAATAACTTCCGTACCATCGGGCTTGAAATC
ATTCGAATAAATCCATGGGGAAGGATCCTCACCAGCAATTCATGGGATGCTTTGTGGTGAGTTACCCAGATACTGGCAATATACTGATATGTTTCTTTTG
CATTATCGGAGGGATGGAAAAACGCCTTGTGGAGGTGCCTTAGAGTCAGTCCGGAATCCAGAGCAAGGTCACAAATACGTCGTCGAACTTTGTGATCGCC
GTTGTCAACAATCACCTTCAAAACACAAATAACAGCGGCAGACAACCCTGCGACCATATTTTGTGACGCAAGCTCCAGCAGTAGTGCATACTTCCCCCCC
AAAGCCTTCACGATGACATCAAAGTGATTGTTGTCGGTGCTGTGACGAGAAACAACTAGCACATCTAGCACCAATTGCAACATGACCAATGTAGAGCTGG
GATTGTGTTGCTCCAGCAGGTCAGTCAGTAGCGATATCAGCTTCTTGTGCTCAAACACTTGATACCGAATCGCCTTTTCAGCGGCTCGATGCGCATTGGA
TCGCGATTTATCGGCAACCAATGAATGAAGCGCGTTTACAGCCCACACAGTTGCGATAGGGTCGCCAGAGACCAATACCTGGGCCAGCGTCGGAACAAGA
ATCATAGCTCCACCATTCGACTGCTCCATTGCAATGCGATAACAACCGTCGTTAATGCGACAAAATGTTTCCAAAATGACACAAATCTCGCTGGCACGAA
TCGGAGGCTTGCATGAATGCTCGAGCTAGAAATACACAATACAATATTTCGTTAGAACCAACATATCACGAGACGTCATTTATAGTTTTCCAACGTACCA
AGTTGTTGATTCCGCGTAGAAGAGAACCATATGAAAGCTTTTCCAAACGCCCGCGCATTAACTTTCCCGCGAAATCCTCTATTTCAACGTTCATATTTAA
GCTCTCCAAAGCAAAAGTAACCCGGTTTGTGGCCGACGTGATACTAACTCCTTCTCCACTCATGGTTTCAATCTCCTTTTCCAGGACAATGTGAGCGGGA
ATATACAGTCCGTCGTGGTTGAGGTAAAGAAAGCGTTCGTGCTCATCCTTCAACAAGACCCTTGGGGACATTCTCGGGTTTAATTTTGGGAACTCTCTGC
TCAGCGATACGTCAAAGTTTTCGACGTAGCGATATCCGTCGTATAGTGCCGCCAAGAACTTTTCCATGTCGTATGGCACATACACTACGCGACTACAGTC
TGAGAATTCCAATGCCACCACAGCTTGAGAATCATCACTCCCCAGTTCTGGTATCACTACCCGCCGTAGATTCTTCAGATCGTAGGTCTTTCTTGAAGAA
TTTGAGAATTCTTCAATGGTTCCATCAACAAAGCAGAGCTTTTTCTTTCGCAAGTGCGTTGATCCATGTCTGCCCGTTCGTCTTTGGACATCAAACAAAT
CGTTCGATTGAAAAGCGGAATGGTCCATGGGTGTTTCAACGTGCTGTTTGGGAAGTTTGTCCCGCGTTGTAAATCGTAAGTGAATACCGATAACACCAGC
TAAGGCCCTCATTTTCTCCACGATATCGCTGCTTTGATCCGAATATATGAACTTTAATTTCGTTTTCGCCGTGAGTATGAATGCGTCTGGTATTGATGTG
GCTCGAGTGATTTCTTCAATCGTGCGATACTCAATTTCATGAGTATGACGCCCCACAACTTGAACAGCAATGAGAGCACGTGGCGTTAGATAAAAGTTGG
TCTTTTCTCGTTGGCCATTGGCTGTGCCAATAAATCCATTAAACTGACAACAGTCAACACTGTACACACGCTTGAACTCCTCAAAGTTACCCACCAAATG
ACTCATGAGCTCCTGCAAGAAAACATTTCGGCATCGGTAGCGAAGACGCAGGAATACGGGGTCGTCGTATTGATCTATCCCCATCTTGAGAGCGCCACAC
GCAGCCTCAAGAAATTGCCGGTATTGCCGAAGCAGCACTTCCGGATTCTGGACCACGACTATATTTGATTCAGTTTCAGTGCCACTAGACGAAGATCCTG
CCGATGACAACGTATTGTGGCGGCTTGACGAGAAAATGTTCCTTCTGGATGAATAGATATTGGGGCGAGAAGAGATTACCGGCGCTACGCGCTGGCTGCT
CGGCCCAAAATTCAGCGTCTCTCCAAAACTGAGCGTTTGGCGAGGGACTTTCCCATCATTTGACCGCAGCGGTGAACCCATATTGCCGAAGTGTAAAAAT
GCTGGATTTTTCGTCATTCGACTCAGAATACCCACGCAAGCCTCAACAGTTGCTAGCCCCGGAAAACTGAATAGAATTCGGAGCATCATTCGGTACTTAG
TCGCCAGGTGCTGATACAGCGTTTCAGAAAGCTTCCGCTGCTTTTCAACGTTTGCCTTCACCAGCAGCAGTATAAATTGACACAGCTTCATTGTCGGTAG
GTCAGAGAGGAAAGATCCCGTCTACGTGAACGACACGAATTAAAAAATTAGAGCTAAATCATGTAGCATGAAATGTACGACTGGTGTCAAACTTACATGG
CTGTCTTCGTCTAACATGGACAGTAGCGTCATCATGAAAAGACTGTTGGATAGCAAGAGCTGTCGGCACTGAAGCTTGTGTGCCTTCGACTCCATGAGCC
GACTCAACATCATGAACATCCAATATGTTGCAATCGAGTTCTTGCTAATCAGTATTTTTGATATCATACCGATATACTCGTCTCCACGCTAAAACACACA
GCAAAAAAGAGAAAAGGAATGAGTTCGTCGTACCAATTGCGGCACGTATCAAACGACCAGATTAATGTACCTCCGTCAGAATTTGCATGAACTCATTGAT
AGCAGGAGGCGCGAGAGTTAAACGATAAATCGACTGAAGATATGTACTCACAAAGTCATGCGAAGCACCGTGGCGGTTGACAATGTCATATAGCTCCCGG
GCAAGTACGTACAACACTTTTTCGTACGGTTTGCTGGGTTGTGCGATCACACCTGAAGTCGGCGTATTTGCATTAAGCTCCACTGCCAAAGAGTGCATCT
CTTCGTCAAGCCCACGGGGAAGCTGTCGTTGCGAGCGCGCTGTCTTGCGATTGCCGAGAACCGCCAGTAGCTGAAGAATACTGGACTGTGCAACTCGGAG
CTCACGATCCATCACATTCACGTTTGGCGCAATATTCGCGATCTTGTTGCCCTCTTGCAAAATTATCTTACGCGGGATCATGCGCACCCAATCCGCAACT
TCAGTCATCTCCACACCCACCTGATAGTTCCCTAGCGCGTGACATGACGCCAACAGCTCACACACAATCTTCTCGCGCTGAGCAGAATAGTACTTTCGCC
TGACTCCATCCACGTATACGACTTCAAATGCCTGCAGCGTATCTGGGTACATGATCAGACTGTAAATGCGCGACAGGGGGCGGCTGGAGATCACCGTCTT
CGCGTCCGCATACTCCGTAATGTACTTTTCCGAGACGGACAGTGTCCTCGGAGCAGCAGTCGACTCGTTCGACTGCGAAACCTTTAGCACTTGGTACTCG
AACGACACACCGGTCGTCAAGGAAGCTTTGCCGTCGTCTTTCAACGCCGCTTCCATGGTTTTCTTGCGGTACTCGTTGATCTGCATGCCGTAGGCCTTCA
TGACTTTGTTGATCGCCTGTGCCAGCTCCGTGCGTCGTGGTACGATGAAGAGACTGGAGTTGTCCGAGTGGTTCAGCGCAATGGCCTCGTGGTCGTCACA
GATGAGGTCGATGGAGACCAGACTCGTGTACGGTATGTGGCTCATGAGGTCGCCCTCGGTGTCTTTCTGGTAGATGCCGTCCGGGCGGATCTCCACGACG
CACGTGGACTGCACGCCGCTCTTGTGGTACTTGAGGCTCTGGAACTCGTGCGTCTGCAGCTCCGGGGGCGTCTTGGGCTGCGCGTCGGGCATCTTGGCGT
AGTGCTGGCTGCGCAGGCGCATGAGACAGACCAGCACCTCCATGCGGAAGTGGCAGCGGAACACCGTCTTCTTGATGCGGTGGCGCGGCGTGTGGATGAC
GAAGTCCGTCTCGCCCTCCAGCACGTTGGCGCTGTCCACGTCCTCGTAGGGCCACGTGTTGGTCACGTGCTGGTTCTCCCGGTCCACCGTCGAGAACGAG
TACTCGCCGAAGCACAGCACGCGCTCCTTGACCACGAAGCTGCCCACCTTGTGCACCATGAAGCGCGCCACCACGCGCTTCATCTCCATGGCGAGCCGCG
CTCCTTCTCCTACCGCACCGGTTGCCTTCTGCCTCGCTGGATTTCTCTCCAGCAGCTGGAGGAGCTGCCGGCAGCGGCGATCTTGCTCTTGCTTACGCTC
TGCGCTCTGCGCGGTCTAAACGCAAGTGAAGCCATGCGGCAGAGAGCGCGAAAGGTCGCAACTTCAACTAAGTCCGAAGTGACCATCACTCC