Description :
From Genome Similarity Track
Location :
Scaffold_65:214305- 216076
Transcript NameFunction/comments
Hyaar_Emoy2807546PREDICTED: alpha-taxilin-like
Hyaar_Emoy2807547hypothetical protein

Sequence
1771 bases(100 bases per row)
TCAAATCAACTCTCTTGTCGCGACTGCAGCAATTTGGTCATGCTGGTCTTGTTGAATGCTTTTACGCTCAGCTTGAAAATGGCGACAAAGACGCTCGAGC
TTTTTGATCTTCTCGTGCAGCTTCAGTGTCTCCTCGGCAGACGCTACCTGTCCTTGGATTGAAGCAATTGCACCCGTGTCATACTCCGCACACTTCTTCT
TAAGCGCTAGGTTCTCTTTCTCCAGCATCTTGGTAGATTTGGCCATTCGTTCCATTTCATCACGGAAGGTAGTGAACATTTGGTTGCTTTTTGCTAGTGT
TTCCTGCACCACGTCGAACTTTTCAGAGTACGAGTTGAGCTGTGCTTGCAACTGGACCTCACGGTTGGAGAACTCCTTGGCCTTGTCAAGAGTGCCTTTC
ACCTTCTCCGCTTCAAGCGACGTCAGCTCGACCTGATGTCGCAGTTTCGTTTCGGCAAGCTGGATTTCGAGATTCTTTGCTTCCAGCTGCCGCTGAAAGT
ACTCCTCACGCGCCGTGTATTGCTCAAGAAACGTCTTTAGCTTCTGATGCAGACTACAATGGGATACACAAGCGTGAGTTCTTGCATCCGTCTCGACTTG
TGAGCCAGTTGACAGCACATTGAGTCGAAAACACACCAACATACGTTTCGTTTTCTTTTAGTGACGCCACGTAGTCCTGACTCTGCTTGTCCATTTTCGT
GCTCACTTCTTCGATCGTTTTCTGAAATTGGGCTGACAAGTCACGTCTAGACAGCACGATACACGAGTCAATAATGCGTATATTCCCGTATTATGGCAGT
CCACACGCACATACCGCTTTTGATCCTCTTCGTCAGCAATACGACGGCTTTCACTCTGTGTAAACGAACAAATAGATACCGGGGCATGTCAAATCCGAGA
CGCTGCAACCACCTTACTTCACCAACCTACGAACCACAATAACTTTATTCTGCTTTTGCAGCTCTCGACAGAGCTGTTCCAGCTTGGCCCTTGATACGTT
CGACTTCACCAGCTCGGAGCTTACTGCATCAAGACCCAACTCGTTAGCAAAGCAGCTACGTGCAAAGAAACAAAACAAACACTCAGACACTCATCAAACA
CACCTGCGCCTTTGCGTTGCTTCAGCAGAATACACTTGGCATTCAACTCGCTAATCTTCTGCTGCATCAATGCCACTTGGTCACTCTACGAAAACAACCC
AAAAACAAAACACACCCAAAACTCTCGTTATCACAATTCAAGTCCACACCTCTACACACACACACCCAAAGCTCCGTACCGCTTCATTCAGACTGCCAAC
AAGTGCCTCCACTTTATCTTCAGCCATCATCTCTTCACTCTCCTTCACACTCGCTGCCTTGCTCTTCATCTCAATCGGCAGCGTCTCATCCAAGTACATC
CCTTCAACAATACAAAATAACAAACAAACGTCAAAACAATAACAACAGTACATTGCAATATCGACTCGTGCAATAAAGACAAGCGGCTACTGCTACCGAC
CCGAGAGATCGTCGAATGTCTCGTCGCCACCGACTTGAATCTCGGCAATTTTTCCAGCCAAGAGCTCCCGCAGTTGGTCGTCTCGACTGACAAGCTCTAC
AGTGGGATCGCTCCTGCCTCCGCGCTTTTGCTGCTTCTGAGAGCTCTTGGGCTTGCTCTTGTGCTTGTGCTTGAGGCTTTTCGTTTCGCGGCCGAGCGGT
CGGAGCTCGAGGCTTGGCGTCTCCATACTGCGCGTCTACTCGTCCGACTTGGTCGTGATTGGTGGTGCGCT