Description :
From Genome Similarity Track
Location :
Scaffold_1981:2143- 3406
Sequence
1263 bases(100 bases per row)
GGATCTCAGCCATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAG
AGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCAACCAGGAAC
AAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAAT
CCCCGTTGGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCA
TTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAAGAAGTACTGCGGGCGGTGGAT
CGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCCCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCA
CGGCGCCTGACTTAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGC
GAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGT
TCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCT
ACGTGTGTCGCGGATGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAGGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCG
AGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATTGCATTTATGCAT
TTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATCTCTAGTTT
GCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGA