Description :
From Genome Similarity Track
Location :
Scaffold_641:2143- 3236
Transcript NameFunction/comments
Phypl_g10005hypothetical protein

Sequence
1093 bases(100 bases per row)
CATCGATACACACTCAATGACGGCCTATTGTACTACAGTACGGGTCCGGACGACACTCCATGTGTCGTGGTCCCTCACGATGAGGATATTAAGTATCGGA
TCCTCTAAGAGGCACATTATACACCACTAGGTGGTCATCGCAGTCACGAGAAGACCTACAGGTCGGTGAGCGTCCACTACTGGTGTCCGAAGCTGTACAA
GTGGGTCAGTACATATGCACGCATGTGTGAGACGTGTCAACGGGTCAAACCCTCGCCGCACTCGGCTGCgccgtcggccagcttgtTTGTGCCCGCAGAG
TGTTGTCAATNCAGACTCCAtcgatggagaaggaacAGCCACGCTGTTTATGGATCGCGTGTTCCGCCAGCATGGGCTACCGGGGACGATTGTCTCGGAT
CGAGACCCCCGTGTCACGGGCAAGTTTTGAACACCAGTCTTCAAGATGCTTGGCACGCAACTGGACATGCCCACGGCGGCCCACACGCAGACCGATGGTC
AGACTGAATGCGTGAATGGCGTAGTCGGACACAGGCATCGGAGTGTCTGTGCGGACAGACTCAAGCAATGGATCTCCATGTTCCCACTCGTTGAGTTCGC
ATTGAACAATGCGGTCCATGCCTCGACAGGCTTCACCATGTTCTATGTGAACGACCTCACTCACCCTCGCGTCCCATTGACGCTACCACTCCGTGGTTCT
GGGTTTAGTGATGCAGGAATAGCCTAAGGGCTATCTGATATCAGCCCAATTGCGGGTCGCAAACAAGTTGACACGCTCGTGTCCACGCGTATGAATGTCT
TACGACAAGTACGCGACACGATAGCTGAAAGCCAGGATGTTTAGAAGGAACAGGCTCATGAAAAGGGCAGCCGCAACGTGAACGTGTTCAAGGTAGATGA
CCTAGTTTTATTAAACACTAAGAACTACCTAAACATGCAGTTTCTGCGGTCGTTAAGACTAAGTTGTGCCCGCGATTCATTGGACATATCAAGGTCGTGA
CCAGGAAGGGCTTGGCGTACACGCCCGATCTTCCGACGAAGATGCGTACGCACCCCGTGTTTTACGTGGGCTTCCTCAAACTGTACCGCGACC