Description :
From Genome Similarity Track
Location :
Scaffold_24:214288- 219570
Transcript NameFunction/comments
g4806.t1RAW42825.1 hypothetical protein PC110_g1003 [Phytophthora cactorum

Sequence
5282 bases(100 bases per row)
TTGCCTATGCGTTGAAGCACACAGTCGGCGCCAGCTTGACATCACTACTGGCGATATATAAAGGTGAGCCGGCTCAATCGCAGCCCAGATGGAGTCGACC
ATCTCACCTGCAGGTGCTAACTCGAGAAGAGAGCGCGGGTATTCCAGAGGTCTGCACAGGCAGCAGACCGGCTGGAGACCCCCCCTGTATCCCCGACTTG
GGCCCTCAACGATGACCGTTGCTCCGAACGGCTTTTCATGATCCAAGTCGAGCTTCGAGGTGTCGACCAAAACATCACGCCATCCATCGAGGTTTGCGCG
CGCAACCGAGTTGATGCTCCACTTGTGCAGAGAGCAAGGAGCCGCGCGGCACCGCAATGCGGTCCGATACAAGCTTCAAGCCTAACTGCAAGTGCAAGGC
GTGTGCGGCCTCCACAAAACAATGATTGCCCGTCGACGACAACCCGTCTGTCTGCGCGTAGTCCCACTGCGCGTTAATCGCTTGTATCATGGCTAACGTG
GTTCCGAGTGCAAGTGGCTCTGGTCTCGTGCTCTAGGCTCGGACTTTCCGAGTCGGTCGCCCGGAAATGGCCAGCTCCTCGGCACGGCTTCAATGATGTG
CACGACCGCATCGCTGCCTTGCTTCCTGCAGGGTCCTACAGCAGGACGCGGGACGCATCGGACGAATCCGGCGATCTAGTTGACCTACACTTGGGTGAAC
AGTCTTAGCGACTTACTGTAGGAACTCGGCTGTTTAGCCTGAAATTCAACTGAGTTGGGCCTGTTTGATTGCCAGGAACGCTCCTCTTTAGTCCTTTAGT
GATCTGCCGATCGATCGAGCCGCCTTCCAATTGACGCATGCTGGCGCTCATTCCTCAACTTGCTTCGTTCAAAGCACACCGCTCCGCTTTCAACTGATCA
ACTTTTGCTGAGCTTGGGGCCATGGTGAAGGACATTGAAGCCGCCACGCCAGGCTACGACCTGCACGCCTCGCCCAAACCCGGCTCGATCAATGGGGACG
AGCAGCCTCTCGGCCACCCGTCCATCTGGTTGCTGCTCGCCGTGTCGATGCCGCGGATGGCTATCAACATGGCTTGGTCCGCGCAGTGGGCCGCTCTGGG
GCCCTACCTGTCGACCATGCTGTCCAACTCAGCCGTGCAAGCCACGCAGTTCATCGGTCCCATCGTCGGTGTCATTGTCGGCCCCAGTATCGGCGTCTTC
AGTGACCGCACCACGTCTCGATTCGGCCGCCGTCGCCCCTACCTGGTGGTCGCCGGTATCCTCAGTGTCATCTGCTGGATTGCCATGGGCTACACGCGTG
AAATTGGCGACCTCCTCGGAGACACGGGCGATGGATCGAGCGCCGACAGCGATCGCATGTGGACGACCGTGTTCACCATTTTCTTCTACGCGTGGATGGA
CATCACCGTCAACATTGTCCAGACGCCGGCCATGCTTCTAGTCGCCGACTTTGCCGGTGACCGCCAAACTACCGGCGCTGCTCTCGGTCAGGCTTGGTCG
ACACTGGGCTCGATTGTGGTGGCCGTCTACATTGACGCGTTCGGCGCGGCTTACCTCACCATGCACTGGTTCATGGGAACGCTTTCTGTCATTATGATCG
TGTGCGTTGCTGTCGCGACGGTTTTCGCCCACGAGACCCCTCTCGACCCCAGCAAGGTGGAGCAGGTCTCCGCTTGGACACAGGTCAAGGGCGCCTTCTA
CTCTGTCTGGCTCGGTATCAAGACGTTGCCGAAGGTGCTGGTCATCTACGGCGTCGGCTTCTTCTTCGTGCAGTACGGCTACACGGCCTACAACGGCAAC
AAGGGACAGTTCTTCGGCCTTGAAGTGTACGGCGGAACCTCCGCGAACGCCGATAGCTGCGACCCCTGCACGGCCGAGCAAGACGCCTACAACGACGGTG
TCAGCCTTGCCGGCGGAACTGCTGACCTGCTGTACAACATTGTCGGCTACATCTACTCGTGGTGTCTGCCTTTCCTGGTGAGCAAGCTCGGTCTCAAGTG
GGTGCTCACGATGTCCACCGTTCCGCAGATGTTCCTGCTCGTCATGGCCTGGGTCAGCAACAAGGGCTTCGACGTGTTCGTCGTGGCTATCTGCGGCATG
ACCTCCTCCGTGTGGTTCTCTTGCATTGTGCCAGTCATCATCCACGTGATGGGTGACGATGTAGAGATCGGCATGTACGTTGGTGCCTTGAACTCGGCCA
ACTGCTTCGGCCAGCTACTCAACTTTGCCATCGGTACAGCCATTGTGAACACCTCGCTCGGCTACAAACTTCCGGTGTTCCTGGGCGGAATTATGACCGC
TTTGGGCTTCCTCACGTCTGCGATCTTCATGAAGATCAAGATGTACAGCTTGTAAGGTGTCGATGCAAACCCAGCTACTTTGTATGCGTAGTGAACAGCC
TTCCTGTCTTTGAAGTTCCTTTTTTAAAGCGATAACTGAGTAGGCTTGCACCTTACGCTGCGTGTTCAATTCCTGCCCACCGGGGAAAAGTTCGATACTT
TTTAGTCTATGTGGGATCGTTTGGAGACCTCGGACTTGATTTATTAGACTGAACCACTCTGGTAACTTCTGATGCATGAGCTTCAACCAGAGCGCCGATA
GCGGCTTTCCAAGCTCAAGGAAACTCGCAAACGCTCGCATGATGTCTTTTCAGTTCTTCAGTGATTTCAGAGTTAACATCACACATGAGCCGAGTGGTGC
ATCCTCTTTGATATCACGGTGGTATCGAAAGGTATAGCTGGCTGGCATCTGTTTCACTAATGTCGGTTTTGAGCGATAGTACTCTGTTAGGGGTTCTGAT
ACATGTAAGCCGAACGAAATTCTACAAGACTAAACGCAGATGGCGTGTCGTTAACCATTTATCTTCATTGCCATGCTTTAATAACGTTTACGGCAGCGGG
CTAGACTTATTGGCTTCAAACTCCATTGATAGTTCTGCCACGATAATTCTGTCGTAATTTCACTCATCTCAGCCTTAATTCAGCCTTCTCTTAGCTAACT
CTACGCTTAATTATGGATAGGCAGACTTTGGACAATTTTAAGCTCACGAGAAGTAGGCGGTTGGCTATCCGCCATTATATCTCTACACTGCCTTATTTAT
ACTGATCACAGCTATTGTGCCTTTCTATAATTTTGGCTAATCAGACCATAAAAAACATGTTTTTAGCTCGCCCTCACTGTCAATGTCCGTGCCTCTTGAA
AATATTTAGAGTCCGTTTTACTATAAAATACTCTATTTTACCTAACATCTCGTGTTAACACTCAGGCTTTGTCAGCCAGCCAAACGTCCGTTCGCCATAC
CGAAGAGCGGCTTTCGGGCTTTTCGACAGAGAGGGCATGGTCTTAACGACAAATAATGACTTTCTTGCTTGATCTGAGGTGACGTGGGATTGTTTAGTTC
ACGTGTATCATATTGAACTGAGTCTTGTGAGACTTTGCTTGGGATTTCTGATCATAGTATTACAAGATGGTACCAAAGGCTTGATCTGGCAGGAAATGTA
GACACGAAACCACAAGCCCAGAAGAGCTCGACGTGGCCTGAGTCAGTGCGAGAGTTTGTTTCTGCATATGTAGAGTCATCCATGTTTTTATTTCGAAGAG
CTGCGTGCCGCTATACTAGAGGAATTTCCCATAGGGAGTGTCTCTCTGACGCAGCCATATGTAGAGCTTTACGGTTTGACCTAGGATTGACTCGAAAAGT
TCTAACAAAGCGTACCGCTAAACGTTTGCCACATGAACGTAAGGAGTTCATTTCTCATCTTTTATCGTTCTACTGCGGTCCAGATCAGCTTGTCGTTATC
GACGAAACTTCGGAAGACGGAAGGCAATGTGTGGATTGTTTTTTTGTTTTTTTAATAATGGAGCCGATGGAATCACAAGCTGAGGCATTAATAAAATTCC
GATGTAGATATGTATTGTAACGTCATTGTTGGTCTGCACGCAGCATGGCCGCCAATGTTCGTGTCCCATTTTCAAGAGGCAAGTGGGTATCGGTACTTGC
TGTAATGGGTGTTACGGACTTATTTGCCTGGGACTACGTGGACGACACCTTTCACGACAAAACTTTCACGAGATGAAGATTACTCCATTTTGTTACCCGT
GGCCACTACCTCGCTTAATTGTCGTGCTCGACAATGCCAAGATCCACATGTACGATGAGTTGCAAGCCCTCATACATACCGCTGGTTCGGTACCTTTTTT
TCCTGCTGTCATACAGTCCCGACCTAAACCCGATTGAAGTGGGGTTTTGCTATTGAAGCAGTGAATGCAACGCCATGCCAACATGGCTTTTCGAGAATGC
CCGAAAACAGTACTAGATGTTTCCATGCGTCAATGCACACAAGCTAGTGAAGATGTTAGATTGAATTTGTATGGTCACAGCGGATACAGTATTAGCGAAA
TCAACCTACGTAGTCGTTAATACACTTCATGATCCATCATCCGGCTCCGATGATGCTCAACGTCATCTATATAGGCTTCTGGAGCCAGCGTGTCCATTCT
CGTAGCGAGCGAAATGGAGGGCGGAGGCTGTAGAGGGGAAGACCGAGGCGCCGGCACGATAGCCCCGTGCAACATCGCACGGACGCGATGATACCCTTGC
TCTCCATCTTCTTGTTGGTTGTTCTGGCGGCGGCCTGATGATGCCCCCAGATGATGAGCATCAGGGGGCTCGATTCATGTAAACAAGGATGATCCACCCA
TGCCGATGTAGCTGAGATCTCACCGAGGCCGTAGGATATCACAGGAGGCATGTGAGGACGCTGTGAAAGCGCCACTAGCCTCGTAGAGAACATTCACAGT
CTCGGTTGCATTTTTTTTCTAAGCAAGCTAATTCATTCACTTTGCAATTTCCTTCTTTGGCCACGAGTCCCCGGTCGCGAACGCCAGGGACACAGATCAT
TGGTGGAGCTCTTGTTGGACGACCGCTGCTTGGTGATCGATGTGCTGCAATTGGCGACACGTTATGTTGTCTAGTACCTCAACGGGTGTGTCGTCTGGTA
GCCTGGCCTGGTTACTAGCAGCGTACCGTTGAGTAGAAACTCCTTCATCGATTTGATGTTTTTGCATGTAGGAGATAGCACGACGGATCTGCTCACGGAT
GCGGCTGTCTGTATCTCGTCTTCGCGACGTTTGTCTTTGGGTTCGACGCCTCGGCAAGTAGATGGATAGAAGCAGAACAATTGCTGCGTGACCGTCTTGC
CTTGTGCCAGATTGCCTCCAACGGTAGACGCATGTCAGTAGTATCACTTATTAGAAGCACATATTTCCTTTGAGGTGCATAG