Description :
From Genome Similarity Track
Location :
contig_53:214241- 215898
Transcript NameFunction/comments
g8796.t1hypothetical protein
g8797.t1hypothetical protein

Sequence
1657 bases(100 bases per row)
CTTGAGCACTTTGTTCCAGCGCTGTAGACACTGTGCGTGGTTGCGGCCGTCCACACGGGAGGCGATGGCCTTCCAGTTACGCTGGCCGAACTCGTCCACC
GCTCTGCGCAGCGCGTCATCCTGCCCGGGCGTCCAGCGCTTGCCCTTCTCCTCCTCTGCGCGGGGCTTCTGCGCATCACTCGGCACCTCGTGGAACGAGC
GCAACGCGTCATCGCTCGCGTCGCGCTCGCGCTTGCTGCACAAAAAATAAATAGGGTTCGCACACATAAGAATGGGTCCGCACACACAAGAAAGTGCTGC
GCGCGGAGCTACGCACAGTGCAGCGTCCGCTGCGTGATCGTGACAGCAGCAAGGCAAAACAGGTCAGAACACGTCACTGGGGGCAAAGTGGGCACAGGGA
GCGCACCCATAGTAGAGATCGAGAGCTGTAGGTTGCAACGCGCTGCCTGGCGCTGGTGACAGAGTGCGAGGGGCGGCGCACTCAGCGGTCGACTTGTTCA
GGACCGCGCCGGGTTGCTTATGATGACCCCCCAGCAGATGCCGAGAAAAACACGACTTTCGACCAATCAGCGCGCGGTCAGGACCTGCGGAACTTCAAGT
TGACTCGTGCTTGTGTAGTGTGTACACTTTGCCGGTGTTTGTCGTGGGCTTGTGTGCTGTGCAACTCGTGTGCTGTGCAATCCGCGGCGGGGTTGAAGTT
CGACTGGCCCGACCAGATCGGTGCTGGGCTTTGTGGCCGTGCCGAGTGAAATGCGGCGTCCGTCATGGCGAGATTTGGCGTCGGTCTTGCGAGCGCCTTG
GGCATATGCAGGCTTGACAACACGCCAGTGCTTTCCATCTTAGAGTTTTATTGTTATGTGGCATGTAGGCAACGTTACTCGGCGGCACCGAAAGTTCAGC
TTTGCACGTCGTCACCAAGCACCACTGGCGAGTGTGACCAGCCGCATTCAAACGCGAGCCCAGCAGAACATAGTCGTTGCCACGACAACGACGTCGCTTC
CGCGGTGGACTTGGCACTCCATGTTCTACCGCAGACTACGGCGTTGTCGAGCCTCGTTTCCTAATGCCGGGTATCGTCGGTGTTAACTGCATAAGTGCTC
GCACAGTAGTGGAAGTCTCGCAACGCTGGCGGTCCCCACGATGAGGACCCCACATGAGGACGACCCTTTCTGTCGCTGCGACTCGATGACGACGGAGGCG
TCGAGGCAAATGCGTGGCACCACTGGCGGGCTGTGCCTTCGAATCGTGGGCGGTCTCACATCATTCGTTTGTAACGAATGCTGTGCAACTTCAGAAACCT
CTGCATAACTGATATAACGTCAGTCGAAATCGAAGCCCTCCTCTCTTTTATACATGTATGTACTCTATGTCCGCATGCCCCGTTAAATCCGGTACATGTA
TCTATATGGTGCGTCATTGTGTATCATCTCCAGCAGCCCCCTCTTGGAGAACTCACTCTGCCATGCTGTCGACTAGTAGCGCTGCTGCAATTCCTCGCGC
CGTGGACACTCCGTCCAAGAAGGTTGTGCAGACTATCGATGGCCAGAGAATCGTCCGCGTGTGCGACGCCCGTCTGGCCTACGGCGATATCGTGGGCGAC
GAGAGCTTGGGCGGACGATTGATGAGCGCGGGGCCCCTTCTAGACTTGGTGGACCGA