Description :
From Genome Similarity Track
Location :
Scaffold_14:214183- 215282
Sequence
1099 bases(100 bases per row)
AAAAAATACACGCCTAAGTTCCCGGAACTTTAGCCGCACTGAATTTAGTCCCTGGCACCAAGCCAACAGAGATTGTATTAACCCATTTATCCTGCAGCTC
GTCAGCATAACGGTGAGGACTCTAGAGGGAACATTTTCTGACATAATTAACGGACTTCCAGGAGTCGATCAAATTGTTTAAGGAATATCAAAGACCTTAA
CATTAACGCTCGCGACCAATGACTCTGGCTTATATTCCCTCCCCGTATTAGAGTGTACAGAGGTCATTGGGGATAAGTTCCTGTGACGAAAACTTCCTAG
ACAATCCGTAGAGCCTATTTCTTCCTTAGCAGGGCGTCTTGCGCCATCTAGAATGCGACGTTTTCCCGCGCCATACCGGACTTTTGGTTATCAACGGAAG
TCCGGATCGAAAAGGTTAGACGTGCCTTATGCTATTGACATGTTGGGGAGCAGGGGATCATTGCTTCCACGCGTAAACCATCGGCGAATGTTCCAATGCT
GTTCCACAGCCCGAAGCCCCGCTTCTGCATCCGTCTTGAATGGACGAAAGTCCATAGGCTCTGGCATATTGGACAACCTAAATAAGTTCGACGAGTTTAT
TTTATACCCATGGGTACTGTAACGGGTTGATTTTAAGTTAAAATCAGCGTTCAATGTTACATCCACCGTTGCATCAAAGGACGTGGGATGGACCCGGAAT
ACTTCCGTTCTGGCCTCGCCACTACGTATTCATTTTATAATGATGGTAACTAAATTTCGTTTTCAGTAAGGGATAAAGCGCATGGAAACGAACACAGTTC
TCAGCTCTTGAACATAGCCCGAAAAATTTGTCTTGTCATGGCGAGTAGCTAAGAAGCGATAACGAACGCGATATATTAGATTGGGCGGGGCAAACGCCTA
TGATAATTGCTTAGGTGATCCCATGTGTCAAGACCCTCTTCCACATACGTGCTACACGTAAGATACCACTCTATGGCTCGGCCATCTGGTATTGAGATGT
ACAGACCCACTCGCTGTGGATCCAATGAAGCATAGCTAAATTCATGGCTATTCCCACTTCTCGGACCCACAAAAGGAGATTCTCTCCCTTTTTACACTC