Description :
From Genome Similarity Track
Location :
Scaffold_628:21416- 22596
Transcript NameFunction/comments
Phypl_g9915hypothetical protein

Sequence
1180 bases(100 bases per row)
GTTTTGGTAGAACGATCGCGCTGCAGGGAAGCATGTCGATACGTAGCgcaagctgccgagcagcTTGTTTACCGTGGACTGGGAGCTCTTCGACTCGTCG
GACACTTTCTGAATTCGTGATCTTGCTTTTGCGATCTTGTTCTCAAGCACCGACACCGTCCCTGCCGTTTTGTCCCAAAGCAGGCCGAGTGCCTTGGTTG
TAGTCGACCACTCTGTGAATTTGTCCTCGTTGATTGTAGTAGGCCCCAGCACTATTGCCATAGCCCGTCTCAAGGCAAAGTTGGCCTCCATGCACCTGAT
TCTTCGACGCATGTGTGGTCATCACACCAGACATTGCCGACCAGCGGGCTTGGGTGAGCAGGCGCAAAGGCGCGATGcggtcgttgctgctggtagagGT
GGTTGATTAGAGACCCAGCTAGCGAGTAGTAGGCAGGAGAATCACACCAGCCAAATCCACATGCGAGATCAATGATGACAACGCCTTCGAAACGAAAGGC
GAACATGTGCGCGCTCAGTGCGCTCATAGGGATATGGCGGAAGGTACCGGACACATCACCGAGCATCACCAGGATAGGATGTCCAGGATAACGGGCTCGT
AGATCAGCAATTCTGCGCGCGATGTCTCCTGGCGGGTTGTACGAATATCCGGAAAATTGGTGCGGTCCGTGAAATCGTTCACGGCTGCACCGACCGGGAA
GGAGTAGTCGTTGATGACGCGAATTGACGTCGAACTGCTGGATTTCATGACTACAGCGACTGGGCTGATAAATATGTTGGTCCACAGATCTAGTAGATCG
GCGTGAACGATCAGGTAGCGGCCGCCCTGGACGATGTGTTCTCGCACTTGATCCGCGTGTATTTCGACCGACTGTGGTTTGGAGGCGGCTCCGCCTGAAG
TTGGGGTTTGTCTGGCTTCCAGATCGGCACGACACCATTGCGAACGACTGCATTCCAGCGTTGGATCCACGGACGGATACTGGAGTCGGACGGAGTTGGG
AGTTCGAAGATATCCTTGTTGGGTCGTGGGTCGGAAGGTGTCTGACCTCGATAGATTTGCACGAACTCGGCTAGTGATAGCCCACAGCGCCGAACTACCT
CGGTATCTGCTTGAATTCGGCGCCGATCTAGCTGGCCACCTCGAGAAATCGAGTGCATTGGCATGTTCACTCGCCATTCG