Description :
From Genome Similarity Track
Location :
scaffold_56:214131- 216932
Transcript NameFunction/comments
Plaha_PHALS_04330hsp70-like protein

Sequence
2801 bases(100 bases per row)
CAATACAATCGACCAGATTTACTTGATCAAATAAGTGATCTGAATTACTGAGGTAGAGTCAGAAACAAAGTTTCATCCCTCACTGCTGCAGTCGTCAGAC
TTCCTTTCGGTTCTGTCTGAGCGAATCTTATGACTGAAGCTTGGTCTGAAGCTCATCGATTCTTTTTTGCTGTGCTTTGAGAGCCAAATGAAGGAGCACA
CAGATCTTAGAATAATCGATGCTGAATTGTACATCCTTATCTTAATATCGACGTATTCATCTTCTACTTCTATACCCTCTTGTTCCGTAAAATTTATAAC
ATGAGGTAGTCCAGCTCTAATTAGATCTTGAGCAATATATCCACATTGTATTGGAACCGACTCATCTTGACTCTTGTAGCGATACAAAACAGAATTCACC
TTTAGTATATTCAAAGAAGGATCCATATCAATGATATCCTTCTTTATCCTCCGATCTGAAGTGGTATAAATACCACTCGTCGCTAATATTGCACCTGCTG
AACGAACCCCTACCGCGATACTTGTCAGCGGACCGATCGAGGTGATCAATCCCCCAGACTTCAAGAAGTAAGCTACTCCTGATCCTCCGCATCAATGGTG
AGATACTGTAGAGGCACAGTAGAATCCTGCAGTAGCTGGAGCACTGCCAACTGCAANNNNNNNNNNCGAAATTTATACTCTGTGATTTCAATGGCGGGAC
AGCGATTCGCAAGCGAAAGGACTAAACCACAGGCCCAATGAAAAAGTTCCAGATGTGTGAACCACTCTAGTGTGCAACCACAACGACTAGCTATCGAACG
TACAGTTCGTGCTCAGGCAATACCCTTTGCGACCTAGTACTTCCCCACTATGTGGCTGGTACCAATAATCACAGGACAACTCGATACTGGCTATGCCACC
ACGAGTGCCCAACCTTGACTTGAACTTGAACTGAGGCTTGACACGACACGTGCTACTATGTCACGTAGCgcaggcgaggaaacgttggcggaggaaggcg
aagtcgGGAGCGCAAGGTGAGCGCTGGCGGAGGCTGTTAGAGAGGAGGGCCTGCTGGCTTAGAGGGAAAAGAGAAGTGATTTATTGATCGTTCAGTTTAT
CGGGACGCTGAGCTTACTAGCCACTCGTCCTTGGCGACCTAGACACGCAACATGTATCCAGGTCCCATNNNNNNNNNNATGCCTTAAACTGGCGCCTTAG
ACCGCTCGGCCAATTGACCGCTCAATATATAAAGCTTNNNNNNNNNNacaaggctaattaactcttttgtttaaatccaaaactgactttatttattttg
agctgcggcaaagccgcctaattttaaatgtatagattttcttaaatacatatagtaaaattttaatacatgcatacctactggctacccagccacccAA
ATACGGTATTCTTAtatgggtgcagtcacaccatgcctatctcgtgtgacacacactccTATTACCAGGAGTGTGTgtaccctgttaccagggtacgtgt
aacccggtTACAGCTTACGCAATCCATCACCCAGGGTAAAATCATATCAAAAAATCTTCAAAATGAGTTTTTATAGTTCTGGCAATTATAGAGATATGGC
AGACAACATCAGTAGTTGATCGGGCTCGAACAGCGAGTGACACGAGTTGGAGCCCATATGCACTTACCACTCGGGCTCTTCATTAGTTGATTTGTGATGG
ATATTCTTGCGGTCTCTAATAGATAAAATACATGTTAGATGTAATTTATAATCGAATAAATTACGATTTAGTATCAAGAACCTGAGCATATAATTCTGAT
TTAATCGCAGAATGTTCCGGATCAAGAGATTTCCCAATGCTAAACTTAACGTCATTTGAAGCTGTGATTGGCTGTACGATGGCTGCAGCTTCGAGAACAT
TCGACAGGGTTGAAGCCTTCATAGAAGCTGACGATTGATCAAAACCCTACATTTTACAAAATTTAAGCCAATCTGATTCTCTTACAACGAGAGTTTTGCC
GTCATCGGAATAGTCTCGAATGTTGCTCCCATTAATCTCCTCCTGTCATATCCTTCAGCCGACCAGTAGTCCGATGATTCATTTCCAAAGTTCCTTTGTG
GATAAGAAGACAAGTTTAAACAAACCCAAATTTCTAGTATAAGATGGCTCAATCTGTATCTGGATACTCCGTCGGTATTGATCTTGGTACGACGTACTCC
TGTGTCGGTGTGTGGCAAAACGACCGTGTAGAAATCATTGCCAATGACCAGGGTAACCGTACTACTCCGTCATACGTGGCTTTCACCGACACCGAGCGTC
TGATTGGTGATGCGGCTAAGAACCAAGTGGCCATGAACGCGCACAACACCGTGTTCGATGCTAAGCGTTTGATTGGTCGCAAATTTTCGGACCCGCTTGT
TCAGGCTGATATCAAGCACTGGCCATTCAAGGTGACATCTGGCGCTGGTGACAAACCGCAGATCGTTGTACAGTTTAAGGGCGAATCGAAAACCTTCCAG
CCTGAAGAAATTTCGTCCATGGTGTTGATCAAAATGCGTGAGGTAGCTGAAGCATTTATTGGCAAGGAAGTAAAAAATGCTGTTATCACGGTTCCTGCCT
ACTTCAACGACTCGCAGCGTCAAGCAACTAAGGACGCTGGTGCAATTGCTGGTCTTAACGTACTTCGTATTATCAACGAGCCTACGGCTGCTGCTATTGC
ATACGGCTTGGACAAGAAGGGCGGTGAACGCAATGTGTTGATCTTTGATCTTGGTGGAGGTACCTTCGATGTTTCGCTGTTGAGCATTGAGGAAGGTATC
T