Description :
From Genome Similarity Track
Location :
Scaffold_90:214130- 219325
Sequence
5195 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGATTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTACGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTTCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGAGCTCTTGGAGCATGTCCAAGAGAAGATGTGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCGGAAGCAACAGCTTTTGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGGGGGCCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGAAC
CTCAGCTATGCTGAAGATGAAGAAGCGGAGCTCCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTCGAGGG
CCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAATTCCCAGTAGGCGCGGGGCGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGATGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAATGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAG
GTCTCTGTCGACCTTGGCGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGG
CATGGCTGGAACGCCAGGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGCTGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTG
CTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCGATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGT
GGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGC
CCAGAAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTAAAGGTCGAGGACCTCTTGGCTTTCAGCCGAGTACACTGTATCCTCTTCGAGGAGTGATGG
TGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCACCACACCGCCCTCATCCGGCCGGGCTTGGTCGCGGAGAGAGAGGAGAAGAAGACGCAGGGCGTCT
GTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGAGGATCCACGTGATTGCTGTGAGCAGCTGTACACACTCGTGAACGGAGTGACGG
GGGAGGTAGAAGGAGACATCAGCCTCGACACTCTGCCCGCTGCGGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAA
GGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAACCAGCG
CTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGACCCCTTGTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCAA
CGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGCTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTG
CGACGTCATTAACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCG
AACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACA
TGGTAGGCTGTACGTTGTACAGTGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCACGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCC
GAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGG
GCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGC
TCGAGTGCATGCGCACTAATAAGTTGTATGCCCACTTGGACAAGTGCGTCTTTGGCGCGGAGGATATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGG
CTTAAGGGCAGATCCTGCCAATGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACTAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTG
CACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACACACCATGGTGCTGGAACGTTGAGCACGACGGAGCCT
TTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGGCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAAT
CGGCTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGTCAAAGA
GCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCG
ACACAGTCGCCTAATCTCTCTCAGAGAATGGCAAGATGGCTTTTCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAG
TGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGA
CGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATAC
TCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTACG
AGGTTCATGATACGCCCGTGGGCGGGCACTTAGATCGAGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAATATGTATAAGTGGGTCGG
CACCTATGTACGCACGTGTGAGATGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGAATGCTGGCAG
TCCATGCGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAG
CGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTTCCTGAGGCAATTGTCTCGGATCG
AGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAA
ACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCAGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCAT
TAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGG
GCTTGATAAAGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCACAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATG
CGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAAAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACC
AAGTTTTATTAAACGCTAAAAACCTACCTACGTCATGCAGTGTCCGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAAGGTCGTGC
CAGGAAGGGCCTAGCGTATACGCTCAACCTTCCAAGAAGATGCGCACGCATCCGGTCTTTCTATGTTTGGCTTGCTTAAGCCATATCAAGACCCT