Description :
From Genome Similarity Track
Location :
scaffold_97:21409- 23048
Transcript NameFunction/comments
Pl_109832hypothetical protein PHYSODRAFT_286376
Pl_109833hypothetical protein PHYSODRAFT_524789

Sequence
1639 bases(100 bases per row)
GTACAGGTAACCCTCGAGAGCGTTACGGCCATCGATACGGTCCTTGACCTTCTTGTCCTCGTCAGCGAACTCCGCGGCCTCCTGGACCATGCGGTCAATC
TCCTCCTGCGACAGACGGCCCTTCTCGGCAGTGATCGTGATCGTCTCAGCCTTGCCCGTGCCCTTGTCCTCAGCGGACACCTGCAGGATACCATTGGCGT
CAATCTCGAACGTCACCTCAATCTGAGGCACACCACGCGGGGCAGGCGGAAGACCAGTCAGCTCGAACTTGCCCAGAAGACGGTTGTCCTTGGTCATGGC
ACGCTCACCCTCGAACACCTGGATCAGCACAGCAGGCTGGTTGTCCTGGTAGGTAGAGAAGGTCTGCGACTTCTTGGTCGGGATCACAGTGTTACGGTTG
ATCAGCTTGGTCATAACGCCACCCACAGTCTCAATACCCTGGGACAGAGGCACGACATCAATCAGAAGCACATCCTTGGTCAGGTCGTCCTGCTCGCCAC
CCAGGATACCGCCCTGCACAGCAGCGCCGTAGGCAACAGCCTCATCGGGGTTCACACCGCGCGAAGGTTCCTTGCCGTTGAAGTAGTCCTTGATCAGCTG
CTGCACCTTGGGGATACGGGTGGATCCACCAACCAGCACAATCTCGTCGACCTCCGACTTCTTGAGGTCAGCATCCTTCATCACCTTCTCGACAGGGCCG
AGGGTCTTCTTGAACAGATCCTCGTTAAGCTTCTCGAAACGAGCACGGCTGAGGGACTCCGTGAAGTCCTCACCGTCCAGAAGCGACTCAATCTCAAGAC
GAGCCTGAGCCTGAGCCGACAGAGCACGCTTGACACGCTCGGCCTCACGACGGAGCTTTTGAAGAGCACGCTTGTCCGACGCAACGTCGAGGTTCTTGTC
CTTCTTCCACTTCTTGATGAAGTACTGCATGATGCGCTGGTCAAAGTCCTCACCGCCCAAGTGCGTGTCACCATTGGTAGCCAGCACCTCGAACACACCG
CCATCAATGGCCAGTAGCGTCACATCGAAGGTACCGCCACCCAGATCGAACACGAGCACATTCTTCTCGCCCTGTGCCTTCTTGTCAATGCCATAAGCAA
TGGCAGCAGCCGTCGGCTCGTTAATGATACGCTGCACGGTAAGACCGGCAATGGTACCGGCATCCTTGGTAGCCTGACGCTGAGCATCGTTAAAGTAAGC
GGGCACCGTCACAACGGCGTCAAACACCTCGCGGCCGATGTATCCCTCCGAGATTTGCTTCATCTTGGTGAGCACCATGGCCGAGACTTCCTCAGGAGCG
AACTGGCGCTTCTCACCCTTGACTTCCACCTCAATGAAGGGCTTGCCGTCCTTGTTCACGAGGTTGTACGGCAGCAGCTTCTTATCGGCCTGCACCGACT
TGTCATTGTACTTGCGACCAATGAGACGCTTGACATCGAACAGTGTCTTCTCCGGGTTGATCGTAGCCTGGTTCTTGGCACCGTCACCAATCAGACGCTC
GTCGTTCGAGTCCCACGCGACGTACGAGGGCGTGATACGGTTACCCTGGTCGTTGGCAATGATCTCCACCTTCTGGTCCTTGTAGATGCCTACGCACGAG
TAGGTCGTGCCCAGGTCAATGCCGATCACGGGGCCACGC