Description :
From Genome Similarity Track
Location :
Scaffold_29:21405- 32532
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.21Ubiquitin protein ligase E3 component n-recognin 1
Pytir_DAOMBR486maker-pir_contig_29-snap-gene-0.30Gene of unknown function
Pytir_DAOMBR486fgenesh-pir_contig_29-abinit-gene-0.100Gene trap locus 3

Sequence
11127 bases(100 bases per row)
AGCTTTTGCAACACGCTACTAACGTCGCTGTGTGGCTCGGGAAAAGACAAGAAAGCGAGCCCGCAGCAGATCATGGAGAAACTGACGCGCAACGTCCGCA
AACGTGTGTGCGGCGCAATCTTTTCTTCCGATGAGATCGCATACAGCTGCCGCGATTGCCAGGTCGACTCGACGTGCGTGATCTGCCAGGACTGCTTTGC
GCATAGGTACGTGGTGATGTGGGTTGTTTCATATCTCTTTCTGTGAGTGACTTTTACGACTTACTCATCGACTGACTTCGTTTTGTGAATGCAAAATGAC
ACATAGTGATCACACGGGACATGACGTTTATTTTCAACGAACAACCGCCGGTAGCTCCTGTGACTGCGGCGATCCACATGTACGTGAAAACAAAAAAACG
CGTCAATAACAAAAATGACCCGAATGAGAAGACACACTTACTGACCTGCTTGTGCAATATGCCCTTGTATGTTAATTCTTTAGGCCTGGAAGCCCAGCAG
CTTCTGCTCCAAACACCCAGGAATCGATGATGCGGACTTGAGTGTGTCGAAGAAGCACAAATTGCCGAAGAATATCGGTCTCGCTGCTCCGGTCGTGGTC
GACGCAGTGGTCGAGCACTTGTTCCAAGTACTTCTTGGCGCGCAGCAAGGATTCGAATTGGCTGAGGCAATGGAAGTTTTCTCACGTAACCTTCCTTCCC
ACATTCTGAGTGAGATTGTCGATGAAGTGGACGACCAAGCTGCTGGATCCAACGCGGAACGGTCAACTACAGTCACTCGTGTGGCTTCGCGAGCTTCGAA
TGCGATGGCAGCTCGTCGAGGTCGAAGTAGAAGAGCCTCTCGTCATACAGAAGCAGAGGAGCTGAAGAGTGAAAGCGAGGGCGTCGAGAACGAATCTGCT
CCAGTTGCTTCCTCTGATCGCGCAGTCACACAGTTCAACATCCGACTTCACAATGACGACGTGCACACGCTCACTGAAGTGGTGAATCATATCTCCAGCG
CTGTGGACGTCTCCAAGGCGGTTGCCCGTGATATGGTGAATGAAGCAGACCTAGTTGGCGATGTTACCGTTGCGACGCGAGATCTGCTCAAGTGCGCTTC
CGTCGTTGGGGATCTTCTTCGAAGTTCGATGAATGTCACTGTTGCCCCAACGTGGTGGCAGACTCACATGGACTCGGTTTCGGATATCATCCAGTGGCTC
TTCTCGCTCAGCTGTGCGTCGGACGGTCTGCACGAAATTGTTTCAGAAGCGCTTTGCAAAGAGCGGGCTCCGATCGTGAAAGGGTTCGAGCCGCTCTCTG
ATGTGCTCGCTGCTGGCGGAAAACACAGCATTGAGGATTTCTTCAAGGAACAAAATGCGCGGATAAACGGGAGTGCAGTGGAGTTGTTTGAAGCTGTAGT
TGGTGCAAAGGCAGTTGCTGAATGGGCTCACGAGCTGGAAAACGCGCAGCGAAAGATGTTCAGCTTCCGACAGAAATCAGGTGAAGAGGCTCCAAGCATC
GTGCGGAATGTGAATGGAGATTTGGTTCGATGCGAGAACATATTTATTGAAGACTTCCTCAAGTCCGTCGCGCTCAGTAAAGCGTACTCTCGACATCAAA
GCGTTCGAGACGGTGTGGACACTGTGGTGGCGAGGTTTTTCTCTGCATCTGAAGACACGGGATGCTTGTCTGGGCTGGCCTTGCTCATCCAATACGACTG
CATTCTTCGCAAGCAAACTGTGAAGAACTCGCATCTTCTTCTTCGAGAACACATGCTTGGCGCGCAATTCCGAACGGAAATGCTCGAGTCCTACGTTCGA
TTGTACAAGGCAATGACAACGAATTTTCTTCGAGGACTTGGCAATTCTAGCGACACAGTGTTCGACTTTGCGGTCCAGTTTTTAACAGTACCGCATCTTG
TGAAGAACTACACGAGAGAGATGACGCGGGTCCACCCAGAGCGACCACATCTCTTGGGTGAACTGCTTGCTTCGTTGGAACTGGTGTTCCGGTCGGCAAT
CAACCCAAAGGACGGCGTCCTAAACGTCGATCACCCGGCACTGGGCAACCAAAAGTACAAGGTAAGCTGGGACTTCCATGGTGTCAATGCTGCTATTGTC
GGTTTTTCTGACCTTTAATCGCTTTTTTCTTCTTGTCACAGCACTGCGTAGACAACATGGAGTACGTGCTGAACATCGGTGCAATCCCGAACGAACTGGT
TTGCGATCTGGAGAACCTCGGCGTGTGGCTGTCCTGTTTGCAGATTTTGCAAGTACGTTCTGTTTTGAAATGATCATTGGAGTGTTATTGGTGCATGCTG
AATTTACTCATTTGCTTGTGTCTGCTACAGAATGGAGATTTGCAGGCTCGAAGAGGTATCCGTGAGACTCACGTCGAGTATGAGTCCGACAGCTGGCTGT
CAATGTTCAACCTCGGAATTCGTGTCCACTCGGTCTTCCCAGTCGCTTGGAATGGATTTCAGCCGGAGGAACTTCAAGCACGAAAACTGAAACTTGTCGA
CATTTTCCGTCTCATCACTGATTCTCTGATCAAGAGATCGGTGGAGATGAACGAGAAGGTAACGAAGAAGAAACTGGCGCCAATCACGGCACTTGTCGAG
TCCAAGAAACCAAGCGCGAACTTGAAACAACTGCTCGCGTATGGATTCAATGTCGGTGCTGATCGAACGTCGCTTCACATCCCGCTGCATCGGTTCTTGG
CGGCCTCTGTTCGCCACATCTGCATCCACCAGCCCGGATTTGCGGATTTGATCAATACTGACGGTTTGCTCAACGTGTTCGGCTTTGACGATCTCGCACC
AGAATCCCGCCTCGAGCTCGTGGAAATGCCACTGCGTTGTCTTGTGATGGCGTCTCAGATCCACTCGAATTTGTGGCGTCGAAATGGCGACGAGAACATG
CTCGCGCAGCTGTACAACTACTCGGCATTACCGTATTGCATCCACTATCGCGATTCAGATGTGTTTATGCTGCAGCTGGGTGTACTTCTGTTGGGACCAG
ACACCATGTTAGCGCTGATGCTGAACCAGTTCCAGATTGGCGGATACTTCGTTCGTCCTGCTGCTGAGAAGTCTTCGAGCGCATCGTCTTTTCCAGCGAA
CGAGTTCGGCATTGCGCAGAAACTGGGGTACCTGCGCTTGGAAGAAGGGATCGATTTGCCGCAAATGCTGTTGATGGTGGAAGAGTTCTTGCGTCTGATC
ATCATCGTTGGTACGAGTCTGCCAAGTTCAACTGGTGTCGCGTATGAGAATGAGTTCCTCGCTGAAGAAATGCTGCAGCAGCTTTGTGCCAAATCGTATT
CATTCAGCAAGCTGTTTGACCTGGCGATCTTGCCGTCTGGACAAGACGACTTGTCGATCACAAGGCTGGAAGAGATTCTTGACAAGGTGTCCGACTTTGT
GCCTCCGTCGGGACTTGACGCGGGCCGCTACGAGCTCAAAGATGGGTTCTTGGAGAAGTACAACCCGTATTTTTTGCACCTAAACCGAGAGGCGCACGAG
CTGGCACGTGACAAGTGGACCAGCTACCGGAAACTGTGTCTCCAGAAGAAGAAGGCTAAGGGCGTAAAGGACACCACGGTGCCGATCGAGCCGCTCCGCG
CCGCAGTGACCCCCGTGCCCTTCCTGCGTCCAGTCCAGAACATCTTGCTGTGTGAAGGAACGATCGCGATCGTGCAAATGATTTTGTGGAAGGTGCTCCG
CGCCGATGGAGTGTCTTCGTCGTCAGCAAGCACGGTATCGAACACGGTCTCGGATGCGGTCATCTCCACGTGCCTTCACTTGCTCGTGCATGGCGTTCAC
ACTGCTAATTCTTCGTTGTCAGCGCGCGACGAGTTCTTTTCTCGACTGTGCGCGGTGAACTCCAATTTGGACAACTCGTCGGTGCTTCATTTGTTGCGTA
GAGTTCACAAGAAGCGTTCGACAATCCTCGATGAAGAGCAAGCTGGAACGATTGAATGGCTTGTGTGGAAGATCAAGGAATCGTCACCTGAATGCCGAAA
GTTTATGACTGCGCTGGAAGAAGAAGCCACAAGAGGAAGCGCTAGAGCTAGAGCTGCCGCTGGATCCGCTGGAGCTCAGGTGTCTACTGCAGCTGTCCCG
ATGACCTTGGAGCAGCGCAAGGAAGAAGCCCGCAAGAGAGCTCTTGCAGCAATGGCGAAGCAACAAGCCGCATTCCAGGCGATGATGGGCGACATGGGCG
ATGGCGATGACGATGACGAGAGTGAAGAGAAGGAATCGGAAGCCAATCGGATGGAAAGCGCTTCTGATGACGACGAAGAGTCTTCGGATATTATTCAGCT
GGGCAAGCGCCGAGCTTCAATTCAAGAAACAGATGAAGAGCTGAAAAAGCGTCAGAGAATCGAAGAGGAGGCATGCCACAAGTGCATTTTGTGCCATGAC
ACGTCCACGCAGGGTGAAATGGGCATGACGGCGTATGTGCACCAGTCCACGGTATTGGCAACTGCGTTCCGCCCTGAAGCGCACGAAGCGCTCCGACCCG
AAGGGAAGAAGGTGCGAAATCAAGTCAGAACGTTGATCGAGAAGATGGAGCTTTGCTCGGGCGGACCGAACAGTTCTTCGTACGGAGATATGTCGCCTTC
ACCACCAATGCGTGGATACTCGGCTCCATTTCCAGACTGGTATATGGACGATTCGCTCGCTTTGGACTCGCCGATCCCTCAGTTGAGCCCAGGACAAAGA
CGCCAGCGCCAAGAACGACCCCGATTGCCGGGTACTCACTTCCCGATGCTCGAAGGCGAGATGTTGCAAACTGACGAGGAGCTCGAGGTCTTGGAAGGAG
TGCTGAATCTTCGTGAAGACCAGCAACTGTTTCCTATGGACGTGCGAAGAGCGATTAACTTGGAGCTTCGTGGTGCGCGTACTGGCCAACAAGCTCGTGG
ACGTGACCGAGCACCTCCAGCTGAAGGTGCTCGAGGTCACATGCACCACCACCATCACCACCATCATCACCATCACCACGAGTTCAGCGACAGTGAAGAC
GAAGGAGAAGAATTCACCCCAGGATTCCACGCCGACTTTTCACCACCGGGGATCAGTAGTGCGAACCGTGAGAGTGCCAAGCTGTTCCTCACGCCTTGCG
GTCTTCACATTCGAACATGCCAGCACGCCGTGCACATCCACTGTTTGGAGCGCTACATCAGCTCTTTGCACGACAAGGCGATCCGTGGTGAAGAGTTTGA
TGGAGTGCAGGCGATTGATCCTGATTCCGCGATGACGCAGTTCCTCTGTCCATTATGCAAGACGTTGTGTAACTTCTTGATCCCAACGTCCGACCCGTCG
TTGGCTGATGGCGCCGAAGACGAAGTGATGATGATTGAAGGTGACGTCACCCCAGACGAGCAGAGGAAGGTTGCATCGTGGCACAGCATTGTGGAAGAAC
AGATGCGAGTCTCGGGGTGGTATCGCGTTGTGCTTGGTCGCAACGGAGATTTCAGCGGCGAGAGTGACAGTGTGCATGACTTGTGGAGAGACTACTTCGA
GGAAACGCTGTGGGAACCTCACGGAAGCCTAGAGAAAGGTGCGCCATTTTTATGGTCAGCCTGTGCTTTCTCCCTGGCGTCTTTCCTCACAGTGGCGGAA
GACGAGCACCGAAACGTGTCAGGCAGTGACGCGATGTACGACCCTTTGGTCGACCGATGTCCGCCGTCGATGGAGAAAGAACTCGTGTCTCTAGCGGCTG
TGACGAAGTTCTGTCGATGGTCGTTCTCACTGCTGGAGCACAGTGCGGACGCGAAGGTGATTTGGGAGACGTCGAAGCGATGCTGTCCGATCAATAGCGA
AACGAAGCGCGAGTACAGAAAGTTCACAAAGGTATGGATGGCGTCCTGTGATTGATTAGTCTTGCGTTTGAGTTCACCATCTCATTCTGATTGATGTTGT
TTCGTTTTGTTTGTGTGTATCTGAACAGTTACTTGGCTCTATCGACGCGTGCCTGAGAGGAACAATCCTTGGTCTCCTCGTCGCCGACACTTTTACGGTA
AGAATGTTATCTTCGTGTGGCTGCAAGTGATAAAAGCGTTCTAACCGAGTTCTCTGCATATGCATAGGCGTTTGTTGTGTCGAGTGTCATTGCCGCTGAC
CCACTGACGATCTGGAGATTTATTCCAGTGTTCAGCGTCGCGGATGTGCTCCAGCGTCTCTACGCGGAGTTCTTTTTCGTGGAGAAAACCGAGGACACGT
CGCTGTTCCAAGACAAGTTCTCTGTTCAGGACATCAAGAGCATCGAGCAAGAGACAAAAGAGGAAGAGCTGGCGACGCTGTCGACTGTCAGTCGCACGCG
AAGTGGCAAGGCGATCTCTGGCGGCAATGGCGCTCGCTCGAAACCCGATTCAGCTCCTGGTTCCGTCAATTCGGAATCGCCTGCGTCTATCGTACAGGAA
TTGATGGATGCGATCAAGAGTGGCGGAGAGCAAGACAGCGAGGAGTACGCCGTACTCATTCTGCTGAAGCGAATGATCGCGGCAGACTCGAGCGAGCGAC
TGAAGCCCGGTCTTTCACGCGGCGAGCTGGTTGCGCGTTTGCAGCGCGTCAAGACTGCGAATGCCATGTTTGTGCGACGCATGAAACTCTACTGGCGCTG
TGTGGCGGACCAGGAGCCGTTTGCAAATCGATACGGGGTGTTGCAGATCCCCGATATTCGAGAGATCGCGAAGACGTCGGACGCAGTGCTGGACCAAGTG
TGGAAGTGGTGCGTGGACCGCATGAACAGCAAGAACTACCTGGGCGTGGCCAAGACAGGCGACAAGTGCGAGCATACGGAAGGCGCGAGCGAGGCGTACG
TGGCGAGCATGTTTATTCTGCACGACGCGACGTCCAAGCCTCGTCTGATCGACCTCCCCATCCAGTACGACGAGCTCTATAGCCAGATGACGGGCGTCAA
GTGCGACCGGTGCGAGCGCGTGCCGTGCGACCCGGGCATTTGCCTTATCTGTGGTGAGTATCTGTGCTGTGGCGATGCGTGCTGCACGCGTCCGTTTATC
AACCACGGCCCGCAGGTCGGCGAGTGCACGCGCCACGCGGCTGAGTGCGGCGGCGGCATCGGCATCGTGCTGCTGCTGGACCAGTGCCGCATCGCGATCA
TCGGTGGGAGCATGGCGGCGTACTTCCCGAGTCCATACGTGGATGCGCACGGCGAAGAGGACGTGGGGCTGCAGCGCGGCCGTCCGCTGCGACTTGACGT
GGCGCGCTACCGGTACCTGGAGTCGCTCTGGACCAACCACCGTATCTTCACAGAGGTCTCGCGCCAGCGTAACCAGCGCGAGCCGCAGTACACGGTGAAC
CTGTCGTACCTGTAGGAGGGTTTGTAGATGATGATGATGGAGCGCCTCATGATAAAGTAATTAGGTGCATGTGTACATCTGTATATATTTGCCCACATTC
AATTAATGGAATGAATGAATGGTCATCACGACTTCGTCATCTAGTTTAGTTTTCAGCCCAGGAAGGTTAGATGTGCAGGAAGGTCCGCGTCTGAATAGAG
CTCGTCCTGGAAGAAGACGCGCAGCAAGCGGCAGCTGCCACCGATGCGCACCTGGGTCGTCGTCACGTGCTTGGTGCCGAACGCCTGCACAGTCAGGCGC
TGAAGGTCCATGCAGAGATACCGCCAGCCCCCCGGTGATCCCCCAAACACCAGCGGCAGCTGCACGGTGGAGTCCTCGACGCGCGCGAGCGACTTGGTGT
TCGTGACTTTCAGGTAGCGGTACTTCTGCTTGTCGTCCAGGACCTCGAGCGCGAACTCGAAGAATTGGTCGAGGTTCTTGACGAAGAGCACCAAGTAGCG
GAAGATGTTGCGCGTGCGGAAGAGCAGCTCCGCCTCGGGTCCAAGCACCTCCACGACCTCCTCCTTCACGTCTTCGTCCTCCACGACCGCCACAGAGTTG
CCGTTGAGTAGGCTACGGCACTCCTGCTGCGCCTGCTGGACCACGAAGTGGTCGGCGAATGGAATCACCACCGTGTTCGCATCGTCGTCGTCGTCGTCTT
GAAGGCTGCGACCATCTGAAGATGCTGAAGACTGAGGTTGCTTGTAGTTATTGTTGTTATTCTGCTTGAGCTTTTGCGGTTGCGGCACTCGGTTCCTCGT
AATCACTCGCGGCAGTAGACTCTCGATGTAGATGTCTCCCGGCGAGTACGAGCCTTCGCCGATCTGCACGAACGACGACGACGAGAGTGATGTCGAGAGC
GACGACATGGGCATCGCGGGGCTCTTCATCTCTTCAGAAGCTTCTGACGATTGGGTAATCCAGTTTATGAGCTGACCGGATTCGCTTTTCGCCTTTGCGT
GCGAGCAGACAGACGCGTCCATGCGGTTGACTGTTTCGTTCCACTTATACTTGACGGAAGTGAGCTCCACACACGAACCGACAGATTGATCGATCGATCG
TTTTAGACAGCCATTTGGAATCCCCAACAAGATGGATGCACCAAAAAACACGAGTTCCTCGTCGTCATCCTTTTTTCACATGTACAAGGAGCTCTTCGAG
TACGAGAAGCACGTGGACAGTAGGGACGACCCCGTGACCCTGAGTCAGCGAGACGGCATCGGAGCCAAGACGTTTCTCGACACGTACCGAGAGTGTGAGC
AGCGCCAGGTGATGGAGGTGCGTGCCGGACTCCAGTTCCCACTGGTGTCAACGTTGATGATGGACACGATGAGACCACACGGAATCCCGCTCAGCAGCAC
GTTCTTGCCGTTCACCACTTCAATGACGATGCCACAGCAGCAGCACCACCAGCAGCCAGAGAGGACATATCTCCAGACGTTTCCACCACAGAAAGCGTCG
CCAACACCATCGTTGTCTTCTTCATCATTCACGCGCTCCAAACTCGAAAACAGTCTTCGGCAGTCCGCGAGCAACCAGGAGGAAGCACCAGCAACAAGTG
GCTCATTCTGGTCCACTTCCGCTTCCTCGTACTACAGCGCTGCCCAGTTTCCAGAACGAGCCAGTCCTCGGTACGAGAAGCAGGCATCACCAAGCAAAGC
AGGAGCAATACAGTCGTCCATGCCTCCGCCATCATTGCCGCTCGACACATCAAAAACACATGCTCGCAATCGTCATGCTGTCGTAGAACGATCGCCATCG
TTCCAGCTTCCAAAGCTAGCAGACTTACTCATCGACAGCTCCACTCGCTCCGCGGCCTTGCGGCACAAGCACCTGGACGAAGCCAAGAAAATCGAGCTGC
TCATCGGGAACAACTGCGGCAGGCGGATCAGCTCCGTGTCCACGAACCTGCCGCCATCGATCCGCAGGCGACTGCAAGTTTCCGTCAGGGCTGAGCAGCG
CCGTGAGCAACTCTACTCGGTTCTGCGCCAAGACTACCAAGAGCTCTGTCATCATCAGTAGCAGGCAGCTGGCAGGTGGGATTTTCGACCAAGTGTCTGT
CGTTAAATTACATTCTTTCTCTTTACATCTCCAGCAGAAACGCGTCCTCTGGGAACCCGTCGAAGAGGCTACTAGCAATCGCGTCGTCAAAGAGCGAGCT
CTCGGGGAATGGGTTCGCCTGAGGGTCTTGCTGTTGCTGTTGCTGCGGTTGAGGCACTCCGAGCGTCTGAGCTACACCAGCTCCTGGATTCTGGAACTGC
ATGTTCGCATTCTGCGCTTGCTGCTGTTGCTGAGGTTGCAGTTGTTGCTGTTGTGAATGCTGAGGTACCTGCTGCTGTTGCTGTTGCTGTTGCTGCTGTT
GTTGCTGTTGTTGTGGCATACTCATTCCATACGGGAATGCGTTCATCATCATCTGCTCGGGCATCATCGGAAACGTGTTCATTTGATTCATCATCGCAGC
CGACTGCATCCCTGCCATCGCGTCAAATCCACCCGTGACGGGATTGAACTGCGGTTGACCAGGAAATACCGGCTGGTTGAAAGATGTGTTGAACGGATCT
GCCGGCAGTTGATTGCTGTTCATGGTGCCGTAGCTGTTGTTGAACATCGCGTTCGAGTTGTACATACCCGCTGCCGCCATATTCATCGGCATCTGGCTTT
GCATTTGCATCTGCATCGCGAGATACTGTGGGTTCATCATCGCCATGCTCATCGCCGCCGCAGGGTTCATCATGTAGTTTTGTTGGTTCAAGAACACCGC
GGGGTCCCCAGTATTCATGTAGGAGTTGGCCGCGAATGACTGCGTACCGCTCATCGGGAACGCCTGCGCAGACGAAAGTGTAGCGTTCGAGCCAAGGGAC
GCGTCGCTGAATCCCGTCGACGCCATCGCCCCACTCTGATTCGAGCCGTAAAACGCCCCACTTCCAGAAGCTGTTGGGTAGCCAAATTGCTGCGGATTGA
CGGGGTTCACCATGGGCATCGGTGGTTCTGGAAAGGAGATCAGCGATGGGATTGGCGCAGCTGGCGTCGCGAGCTGCACGTTACTGTTGTCTATTGCTGT
TGCAGCAGTAGCAGTAGCACGCGGAGCTGGTGCTGACGATGACGCTGACGCTGATGCTGATGCTGACGCTGGTGCTGCGGCTTGTTGCTTGAGCTTGTTC
TGCGCAGCTTGCCGTGCGAGAGCCGCCGACGCCTTCGACTTCTTCGCTGTGGTCTGGGTCACCACGGGCGGCGTCGCTCGCTTCTCCGTCGCGCCTTTCT
TCGCGCGGTCCGAGCTCTCGTCCTCGACCGCGATCTGTTTGTCTGCGAGCGACGCCAGCACTTCCAGCCGCGCGCCGACTTGCTGCCGGTATGTCATGCA
CTTGCGAATCCACTCTTTGTGCTCTTTCACCAGCGTCTTTGGCGCTGCGCAACACAACAAGCCGCACATAGAGATGATGAGCACATGATACACACACAAT
GTGTACTACGCTGCTATAACAAATGCATAGACGTACGCTCTTGTGTGTGCAGCACGTTCCACCCGCGCAGCGCCGCGTCGTTCTTCTCGAGCATCGCCTG
AATCTCGCGCGACGAAATCTTGCGCTCCGCCGACAGAAACTACAACACAAACACATAGAGACCCGCACAAGATTAAATACCCGCCTATCATATACANNNN
NNNNNNNNNNNNNNNNNNNCACACACCACCAGGTCCTTCAAGCACAGCCGCAAAAAAAGAAGACGAGAACGCGACCATCGCGAGCGAACCAACCTGTGCT
GCTGCCGCTGCGCGCTGCTGCAACTGG