Description :
From Genome Similarity Track
Location :
Scaffold_242:21402- 23399
Transcript NameFunction/comments
g14263.t1hypothetical protein

Sequence
1997 bases(100 bases per row)
TAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTC
TCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCA
CCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTAC
AGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGG
ACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGTACCATTACCTCGTCCG
GTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTCCACTCCTGCACTGTGATCCATAAC
CCATACTTCAAATTCGTACACACGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCC
AGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCG
TTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAG
TTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGC
CCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACAC
CTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTT
AAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACT
TCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCG
TCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAGCGAAC
GTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGT
ATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGA
GCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATCCCGGCGACGGTTATCGTCTCGG
TAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTA
CCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGATTTTCGCTCCCTGCGACGAAGGATATCATTGATCATATCCTCGAGGTCGTGAAT