Description :
From Genome Similarity Track
Location :
Scaffold_328:2140- 4459
Transcript NameFunction/comments
Phymu_g8663hypothetical protein PHYSODRAFT_566527
Phymu_g8664hypothetical protein PHYSODRAFT_342406

Sequence
2319 bases(100 bases per row)
CCGTATTAGATAGGCATAAGAGACAATTGCGTACAACTAACACGTACCTGATACTGATAGCCAGAAAGCATCGggacggcgtcttcttggtaAGGGTGAC
CAGCGGATATACCATGACCACTGGATCGGATTGGCGCGTAGGCGAAATTTGGTGTCGGTGGCTTATCGCGTGGGTTATTCGCACCATAGCTACCGCCTGA
TAAGGAAGCGGATGCTGATGTGGCTGACGACGAGCGAAGACGTTGCCGTTGGGCTGACGAGTTCTTGTCTTGTCTCGTAAAGAACAGCAGTAGCACGCTC
GGGACAAATTCTGTTGAGAAGTGGATGGTAAACTCGTAGGCAATGTGGTGAACACCCACAGGCGTACGATACTGAGACTCCTCCGACTCCATGTACCCAG
TGCCCATGCCGATCAAGTATACAGCCTTCACTGCGAACAGGACGCATAGGAGAATGCACACAGCCGTAATCTGGTGGAGTTCAACGTCAACAAAGATTGC
TGTTAGTCCCCGCATCATCACGCCTGCTCTTCAAATGACTGACTTACCCTTCGTAACACAAGCTGCCGGGGCGAAGTGGATGCTACAGAGAACGACGACG
CTCCTGAACGGCCAGTAGTGCCGTTGCCATTGCCAATTGCCGCCGACGAtaagtcgaagaagaaatcttCGTCCGGGCTTTGGTTACGGAAGAAATCGAT
GAGTCGAATGCTGTAGTACAGAATGGCAAACAGCCCCACAAAGTAGACGCCTCCTTGCAGTAAGTCGCATCCTCTCCACAGCCCCGCGGACGTGTTCGAC
AACGCGAACAGCAACGCAAAGCCGACATACAGAAGCACATTAAACAGGAAAAACACCCTCCGTGGCCATGGGTGCGCCTTGCCCCAGCACGCGTAGCATA
ACTGCGCCCaaaagagcagcacgagcccGTACATTGACACGAACAGCATGGAGGGAAGCCACAGGAACAGAGTCAGCAGCCTGCAGTACACGGAAGTCGA
CGGCAGCGCTGCAATTTCCTCGAGAGTGGCCACTTCAGTAACTAGAGAGAAGACACGCAGCGTAGAAGcgatgaacagcagcaggaagagtCGTTGGCGC
ATTTCAGATCccgtcgaagctgctgcagccccttcctcctccatcaaAGCGGACTCGGAGCCTCCCACAACATTCACAGGAGCTGGGGGAGCTTGAGGAA
CAGCCATATACGGAGCTTTTCCCGCTGGGGCGGTGCTAGGAGCCTCCGAGGCAACGGCGCTGGAGAGACGCTTGCGTTTGGCCGCGTATTGGCTGTACAG
GACGCGTCCGCACACGGCGCTCAGAGTTAGGAACAGCAGGAtggtcagcagcagcaacaggcgGTCGGTGAGACTCAGCGCCTCAGGACCTTCGCCCGCA
GCGACGTCGGGGTCAACCATGTCCGTATAGGCGATGCCTCCCTAAAAAAGAGGATTTGTGAGGTGGACACGGCGAGTTAGAGAGTGATATGAACATCATT
GGATAGTTGAAGCGAAAGCAAAGTAGATGGCGGTATATATACAGCGCTAAGTGCAGTGCAAAGAAGACATATCGATGGCGACGCTCACCTAGTACGACGG
ACGAAGCCTTTGGATTTACCGGTGTGCGGCCACGCGTGATAAATGTACCGCAAATCAGGTACATATTCTATCACAAAGTGACACACATTTTGATAtcagt
accggtaccgtaCGGTATGATCTTTTGCAATCAATCCTTTTTGTgcatgctgctgcgcgcATTTCCTCGCCGACTGCATCTCCGCCGCACCatgtcttcc
tcctcctccatttgGCACGCAGACGCGTCCACTCGCCGCACTAGCGTCGACCTCTATAATAATTTCCTGCGCTCCACACGCTCCGCTCTGATGCAGTCGC
CTGCTCCCGCCTCAATCCACGTGCTCATGGGCAACGAGGCGGCCGACGCCGACTCCATCGTGAGTTCTATGAGCTACGCCTTCTTGcactaccagcagca
gtcagaCACACTTCACGTGCCTGTGTTACCTATTCCCCGGTCGGAATTGGTGCTGCGTTGCGACGTCACTGCGCTCTTCCAGGCTCTGGGTGTTGACACA
GAAGCGCTggtgttcgtggacgaaTTCCCATGGGGAATTAAGAGCAGAGTGAAGATGACGCTCATGGACCACAATGCACTGAATAACAAGAAGATCCCGC
AGGTCGATGGactggaagtggtggagatTGTGGATCACCACTCGGATCTGGGCCAGCACCTGGATGCCAAGAAGAGGGAGGTGGCGTTTGCAGACGGCAA
TGCACTAGTGGCCAGTACA