Description :
From Genome Similarity Track
Location :
Scaffold_206:2140- 3206
Sequence
1066 bases(100 bases per row)
ACAGCAATCCGGGGCACAGCCCTCGTTGTTGGCACATGCGCCTCCAAGTTCACATGGGAAGGATCCCGGTATGGCTTAAGCAAGCCTACGTAGAACACTG
GGTGTGTGCGCAATTTGCGCGGAGGGTTGAGCGTATACGAAAGTCCCTTCTTAGCAACGACCGTGAATGGTCCAATGAAGCGCGGACGCAACTTTGTCTT
GAAGACAGCGGACACTACATTTGTAGGTAAGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCCGATAACGTTCAATACAATCTCTGTTTTTAGCATCT
GCTTGTTGTTTTTGTTGGTCTTGGCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCAATCGCGTTGCGAGAAACTCGCCTACCTGTTTTTGAA
CAGTAGCAGGGCTGGTATCAGCAAGCCGATAGGCAACCTCTCCTCCACCAAGCCCTGAACTACATAGTGATAGCGTTAACGGAACGCGAGGGTGGGTGAG
ACCGTTTACGTAGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGTTGTTCAATGCAAACTCAACAACAGGGAGCATGGAGCTCCAAAGCTTGGCGTAT
CAGCGCAAACACTGCGCAAAATGTTATTAATGACGCGATTAACACGCTCAGTTTGCCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAAACGGGTG
CCGAGCACCTTGAAGATGGACTTCCAAAACTTCCCCGTGAAGCGGGATCTCTATCAGAACCAATCGCCACTGGTAAGCCATGTTGTCGAAACACACGGTC
GATAAACAGATTCGCTATACCTTCGGCATCAATAGAGTCCGGCACTTCCGCTAGATGAGCCATCTTGCTCAATCAGTCAACAAAGACCACAATGACAGTG
TTGCATTCCGAATCTTTCGGTAGGCCAAACACAAAGTTCATACTCATGGACTCCTAAAACCCATGGGTACAGGCAGACTAGCCAGCGGCGCCGCCGCATG
TGCTGAGGGTTCCACCCGTTGACACGTTTCACACGCACGCACATAGTTTCTCACCCACTGGTATTG