Description :
From Genome Similarity Track
Location :
Scaffold_1357:214- 5362
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1357-fgenesh-gene-0.12OG-Fe(II) oxygenase
Pytiw_DAOMBR242034maker-piw_contig_1357-snap-gene-0.2Ornithine decarboxylase 1
Pytiw_DAOMBR242034maker-piw_contig_1357-snap-gene-0.5ATP-binding Cassette (ABC) Superfamily

Sequence
5148 bases(100 bases per row)
GGCGTACCAGTTGAGCAGCGCACCACGCAGATAGCTCTGGTTTGTGTCTGAGTCCACGACCATCGCCTGCATGGCCTTGACGCAGTGGCGCAGCTCATCC
GGGAGTGGCTTGGCTTCGAAAGTGCTCCCAGAGAAGCGGATTGTCACGTCGTAGGCCTGCTGGAAGCGTGGGGTGAGCACGTCGCGTCCGTACATCTTGA
TCGTGCCTTGCTTCTCCGGGTGGAGCTCCCAAATTCGCTCAAACCACTGGGCATACGGGAGATCGCGGATAAAGCAATTGCCGTCATTACCATCATCGGT
GTGTGTATCAGGTGATGCTGCTTGGACAACATTAAAAACGCGGCGATACCAGCAGGGCACGTGGTAGACCCAGCTCGCCTCGTCCGCTGTGAGGAAGTGC
ACCTGTGCATCGTGAAACACGTTGGCGACATCGATCAGGCTCGAGAGCGCACTCGTGACCGCTCGTGCGTTCGCTTCGACGCAGGCGAACGCAAACGCCG
GAGGGCTGCTGGTGCTGGTGGCGGTGGCAGTCGTCTTTTTCACACGGCGGGTCTGTGGGGCTGTCGTGGCGTCTGCTTCGTGCAGCTTGCGCTTCTCACC
TCGTGTCATTTTTGACGAATGAGCTCCTCATTTGAGGGAATGGCTCAGGATTTCGCGCCAAAAATGAAATCAAAGCTCTTTTTTGGCGCCAAACAAATGT
GAACTTCAACTTGAGACCATGAATGAAGGTCCTTTTGAGTTGCAGTGAGAATGAATGGACACGAAGGCTCGCAACTCTTTACAGTCATGTCACGCCTGGA
CGATGTTGGCGACGAGACACGCGATCGCTGCAGTGAGTCCGGTGAGGATGCTGGCCCACGGGAGGCACCATGTGAAGAACCAGCTGTCTACAGCTCGGTG
TTGGCGGCTCTCGTCCTCATGGGGAGCGAGCTTCAGAAAGCACGCCGCAGGGATGACAAGCACCAACGCGATGCCCGCTATGCCTCCAGTGACGCTCAGC
AGCGTCGCAATGTTGATGGCCTTGGACAGAGCGACGATCTGCACAAGCACTGCGAGCACCAGGAATGTCACGACGATCTGTACACGTGTGTAGCTGCTGG
CGTTCCTTGCTGTGCTGTGGTGCTGGTAGCCTGCCATCTTGCTCTGGAACGCTGCAGTCGACGAGCTGGTTGGTGGTGCGTCCCCACTGGTGATGTACTG
CTGTCGAGCCGCTGGCTGGGCCCTGAAGAGCACCTCCTCCTGGCCGAGCTGCTGCGATCGCGCTCTGCACATGAAGATCGCGGCATATCGAGACGACGCG
ACCTCGAGAGGTACGCAGAGGAGCGCGCAGACAGGCACGAGCAGCCAGAAGGGCAGCATGGACCAGTTATCGCCTTCAAAGTCGAGATTTTGCACCACGT
CGCTCTTCGTGAAGCTCAGGTACGACACGTAGCCGCCAACACCAAAGGTGTACGCCAGATACGCCCCCAGTAGACTCGCAGCCAGCGAAATCCGCAGAAA
GGTGTTGACCGCGCGGTCGCGCATCGCATAGAACGCGTGGAAGGCGTGGTGTTGGCTCGCAAACTGGGTCGCAAGCATGCCGAACGCCTGGCAGATCGTC
GTGGGGACGGCCAAGTAGTCCCTCACAAAGCCCTGCGAGGCGGCGGCCGCGTTCGCGTCGTGGAAAAACTTGGCTTTACCTACGATGCACAGAGACGTGA
GCAGCAGCAGACACGTCGAGACAACTGCAAAGTTCTGGATCTTGCGGTACGAGTGCACGATGAGGCAGAACGAGATCAGCACAATGAAACCCTACCAAGA
CAAGCGAGAGTTAGTGAGTTTGGCACTACAGAGACCAGGCTCATAGCGTACACTTTTAAACTTACGAAGAGCTCGCCAAAGAGCTTCCGGTTCGAGAGGA
TCTTCGATAGCACTGTGGAATTCGTACTCGACTCCTTCGGCCATCCGTCTGCATCAAAGTCGAGACTCAGCAAGTGGCCCAGCAGCACGGGAAAGTCCTG
GAAGATGATCGCCACGTACGTCAGCACGAGTCCGCAGGAGAGCGTCAGCTGCATCACCCCCACTGCATGCGCGCCGCAGACGCCGAATGCGAGCTTGGCG
AGGCCCTGGAGAGAGTAGATGCCGTTCGCGACGCCCAGTTGCACGAGACACGCGCTCGCAAAGTAGCTGACGAGCGTGAAGAAGAGCAGCATGAAGAGTG
TTATGAGAAAGCCGCCCTGGAGGAACACGTAGGGCATCACGACCACACTCGAGCCAACTCCTCCGGCGACCAGCAGCATGGCGACCTGCAGCGACGAGCT
CTCGCCCGGCGCGAGCTCTTCGAGAGGCACAAACTCGCGCGGCGACGATAGTAGATCGTTGCCGTAGACGCCGCAATCGTCACCATGTGACGTGCCTCTG
CCGTTGTGGATGTCGTACGCAGACGCATTCTCCGGCGCAACGTAGTCGTAGTCGCGGTTCTTGCGATACTTGCGCACCGATTTCCCCATCGATAACACTC
ACGCCGCTTGTGAAAGCAAGCCGCCCCTTGTTCGCAACGCGCAGAGAGTTTGGGAACTGGCTGTGTGTCTGCATGGGATCCTTGGCGTTTGCCTTCGACA
TCAGCAATCTGTTTCTCCTGTCTGGGGCGCCTCTTTGCCGCGAAAGCGACCAACCAAGCGGGCAGTGTGCGGTCGTGAACACACGGCTTCTGAAGAGCCC
GCGACGCTTCACGGTATGGCAGCTGTCACCTTCCTTGGAAGCTCATGCATTTTGGAGGCGCACCTTGGGAGACGAACGCGGATGACAGCCAACACCTTCC
TTGGAGACACAACGCAGCGCTGATGAGGCTTCACGAGGTCGCCGCACACGAAATCAGGACGTCAACAGCCTGTTGACGCGCTGTCTTCGGCTCTTCGAAG
TGCTGGCTGTCTTCGGCTGTATCTTTGTCTTCGAAGTGCTCTCTTCGGCTCTGTCATTCCCGTCGAAGCTGCGTCTTATCGGTCCATAGCCTCAAGTTGC
GTCCAATCATTGCCAGATGGCTGCAGCTCATTGGGCGAAGTTTGGGAAATGGGGATGAGCCGGGCCAAGTGAGACCTTCATTGTGCGCTGCTGGAAATCA
GCAGCAGATACCTGGCACTGTGTCATCGACCTTCGTCTGCTGCTGCTACTGCTTGTCGATGGCCTTGTCAGTTCATTCCTCAACGAGCACTGCTCGCGAT
ACAGCACGATGAGCAGCTCCACCGGCATCCAACCGCATGTGCGCAAGGCGACGCTGCAGCACATCGCAGCGGTCGGCGACGACGAGGAGGCGTTCTACAC
GGTCGACCTGCATGCGATCGCGGCCAAGTACGCGCTCATGACGGCGCTGCTGCCGCGCGTGCAGCCCTTCTACACGATGAAGTGCAACCCGGACATGCGC
GTTTTTGAGCTGCTCACCGGGCTCGGCTGCGGCGTGGACTGCGCGAGCAAGCCCGAGATCGAGTTCGCGCTCGCGCACGGCGTCGCGCCCGACCAGATCA
TCTACGCCAACACGATCAAGCAGAAGTCCCACCTGCAGTTCGCGCGCGCGCACGACGTGTCGCTCATGACCTTCGACAATGTCGACGAGCTCATCAAGGT
CGTCAAGGTGTACCCGGACGCGAAGCTCGTGCTGCGCATCCAGGTGGACGACTCCAAGTCGCGCCACCAGCTGGGCGCCAAGTTCGGCGCGCCGCTCGCC
GAGATCCCCGAGATCCTGGAGACCGCCAAGCAGCTGCAGCTCAATGTCATGGGCGTGTGCTTCCACGTGGGCGTCGGCGTGCTGAGCGCCTCGGCCTTCG
TCGACGCGATCGCCCGCTCCAAGGTCGTCTTCGACCTGGCGCACGACTCGGGCTTTGACTTCACGCTGCTGAACGTTGGTGGCGGCTTTGCTGGCGACTA
CCTCGGCCCTGTGACGATCCAGGGCGCGGCCAAGGCCGTGAACGACGCTCTTGACGAGCACTTTCCCGAGTCTGCGGGCGTGCGCATCATCTCGGAGCCC
GGCCGGTACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTCGGAGTGCGTG
ACGCTCAACCTGAATGTGGTCGGCCGCAAGACGGACCCGACGCTAACGGCGCGCGCGATCGCACAAGACGAGCAGCACCAGCAGGCGCCGCGCTACATGT
ACTTTGTGAACGACGGCGCGCACGGATCGTTCAGCGCCGCGCACCTCTTCAAGCTCTACGACCCGGTCCCGATTGTGATCAACGGCACGCTCATCGAAGT
CGACAGTTCTGCCGATGAGCCCGCTGCTGCGGTCGTCCCGGCGAGCGTCTGGGGGCCAACGTGTGACGGCAAAGACTTCATCACCAAGGACACGATGCTG
CCGCTGCTGGAGGTCGGCGACTGGGTGGCGTTCCCGCACATGGGCGCCTACGGCTTTGCCACAGGCTCGATGTTCAACGGCTTCCAGCTCCCGAACACGA
TTTACCTGGAGGTTGAGATCGAGCGCTCGCCCTAGACAGTCCATGCAACTGGGAGTGACTGTGTCCAGGCCGCAGTCTCCATCTGAATCGTACAAGTGAG
AACTCAATAACAAAAGCATGATACATAAGACATACCCGTGTTCGTTGGGCCATTTTTTCCTTCGTTCTGCTTCGCCATAACACCCGTGTCTTGATGCGCC
TAAAACACGAGCTGCGCGCTCTCGAGGAGGTTGTAGAACACGCCGTCGCCCGCCTCCACGAGCTCCTGTACGCTACCAAAGTCCTCGACGCCACCGTCAC
CCATGACCAGGATCTTGTCAAACTCCAGCACGGTGTCCAGTCGATGTGCGATACACAGCAGCGTCGTGTTCGAGTCGAGCATCTCGTACACCAGGTCCTG
CACGTGGCAGTCGGTCTCCTGGTCCGTCGCCGTCGTGGCCTCGTCTAAAATCACGATTCGAGAGCGGAACACGAGCGCTCTCGACAGGCAGAGCAGCTGG
CGCTCGCCCGTGCTCCAGTTCGAGACCATGCTCATGATGTTTGCGTCC