Description :
From Genome Similarity Track
Location :
Scaffold_1191:214- 3266
Transcript NameFunction/comments
g15580.t1hypothetical protein
g15581.t1hypothetical protein
g15582.t1POM71575.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
3052 bases(100 bases per row)
ACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCGTCACGCGGCAGTGGCCACTGCCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTG
TTGAATACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGTCTCGCCTTGAGCGAG
TCCCAGCCTTGTTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGACGAGCTGATTCTGCTCTTCTGCTTCACACGTCA
TCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTC
CGACGTTAACGTCGGAGGATTCTCCAGCCTCATATTCTTGTATTGGAGACCAGTACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAAC
TCCTGTGTCTGCCCAGTAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTAGTTTGCTTGCGCCGTTCACTTCTCGTGCGGAGCC
CGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTTCCCGCGGGCGCACGCGTTCAAGCCCGGC
TTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCG
GCTCCCAGAGCCGACGCGCCTTCTTTACCTCGATGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTCGC
CCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTT
GGGGTGACCGGAGACAGCCGCATCCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTC
GCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACT
TATCGTCCAGTTCGAGGACGATAAGTTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACC
CGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCA
CAGTCCACTAGAGCACGAAGAGATCTCTCTCATCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCCGTGAGATTGACTCTCA
CTGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGCGCGGGGCGCCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCG
TGACGATACCCAGTATCGCCACGACGGCTCCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGAGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGC
ACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCA
TTAGCCGTGGGCGTTCACATGCAGTTTAGCCTGCCGTAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGG
AAGAGATAGATCTTCTCAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGT
ACCGTGCCCTTTGGGCGTAAGCATGCACGTCTTGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGC
TAATTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACAT
GACATAGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTC
TTCCAACGTAGCTGCTTACGTGCAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTTCTTCAC
GATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGTCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGG
GCCTCCCACTCTGGTTCCGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAG
GTTCTCAGCCCCGCGTGCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTA
CTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAAG
GAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGA
TGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGT
GGTGGTCACCTGAATGTATGCTTTAGTGCATGTTGCACTAAGGTAGGAGGTG