Description :
From Genome Similarity Track
Location :
Scaffold_3192:214- 2457
Sequence
2243 bases(100 bases per row)
TCTCAATTCATATAGTACCGCAGCAAACAGCGCGTCATTCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAGCGAC
TGTGGGAAGGACAAGTCTGCTAACGAAGACAGGTCTTTAGGATTCGCCTCCAACCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCC
CCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGG
GATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCT
TCCCCGGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATTAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGA
ACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAATAACTACCCAAAAACCGCTGTCCAT
GTCAAGAGAGCAGTACCAGAGTACTTTATTCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGC
CGGTAATCTATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGCGACGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTT
GCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTACGCACCCTCTGAGCGATCAGTTTCGCGTCGCCGACATCGATGTC
ACATTCGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTTTTCCAGATCTTCTGACATAACCGATTCACTTCCGCC
GGCTCGTTCGCCCCTGGATCCGCTTGGATATCGTCAATCGTGACCTCCTCTGTGGTGATCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTTCCAGAT
CCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCC
TGGCCGTCCTTCTATCTTCGGGGGTTCAGGTACCCTGGTATCAGGAAAACCACCAGTTGGATCCAGTTGGTCCTCTAACGAGTTTAAGCCCGACAGTTCG
GGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTAATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTT
TAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCGTCGTGGATCCAACCTCCATTGCTTGGATCTCA
ACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGCTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTGACGTTCGTGACCTGGAGGTATTGCGA
TCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTTTCTCATATTCCACCCACTTTAACCGATCTGGCAGCTCCCAA
GTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGT
CAGGGAAACAAAGTGTCCCATCAGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGAC
CCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTCGTACGGTATACGCCTTCACCAATCCCAACACAATCT
TGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTT
CATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGA
TCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACC