Description :
From Genome Similarity Track
Location :
scaffold_96:21389- 22519
Sequence
1130 bases(100 bases per row)
TTGTACAAGCGCACAACAGATGGCATAATCACTTGCGTCGCAGGCATCATGAAAAAGCTCATCGTGGTTTGCTATCGCAAGACCAAGAGCTTCTTCTAAG
CCCTTCTacacttcggcaaataccGCCTGGTGATCTTTTGGCCATTCCCACTCAACGTTCTATTTAAAAAGAGTCGTGAGTGGTTGCTCCAACGCTGCAT
AGTTGCGCGTGTATCTGTGCAATAGTTGGTCAAGCACAACAATTGTCTCGGCTGTTTCACACCTATCGGCACACGCCATACATTGATAGTTTTGACTTCT
TCAAGATCTTCACGAACGCCATTTCACCAACAGAGCAGCCAAGAACGATAATTTCTGGTGCAAAGAAagttcatttttttattattctTCGCATAATTTG
GAAGACCTGACGAAGATGATTAAGATGAACATCGACAACATACTCACCACCCGTTTTTTTTACTATAAATGAATATACCGTCGAAGTAATTTGGTGCAAA
TTCTCTGAATGGACGAAGAAGACTCGTGATCATTCTGTTAAATGACGCGGGAACGTTCTTCAAACTTTGTGGCATCACTGAGTGACCACTCCCACATCAT
ACCACCGGGGTTGGTGACTGCACTTAGTGGTGTATCTTTCTCGCGTATTCGGATCGAATAGAAACAATCTTTCAGATCGATCGCACCGAAGATAGTACTG
CCAATCACCCCATCAAGAATCATATCCATGCGTGGATCCGCAGTCTGGTCAGGTATGGTCGTCGCATCTTGTTAaaagcgtgaacaatgcgCCAGCGATC
TGTGGCTTTCCTCACACAGAAGATTGGGCTACAAtgcggagacttgctctcacgcacgtGTCCAGCCTTCTGTCGCTGCGCAAAGAGCGCGTCAATTGCA
ATGACTTGCTCTTTTGGCAACGGTCACAgccgtgtgatacaataATTCGTACCAGAAAGTCTGTCAATCTCACGACGAATGCCTCTGTCAGATGGCAACT
CGTTCGGCACCTTGTCTGGAAATATATTAGCATGTTCCTTGACAAGTCCATACACGGGATTTTAGCTTAAAACGTCCCACGACTGCTCATCAACCTTTTC
CTTCCGTGCCTTCTCATCGAGTACTTCCGC