Description :
From Genome Similarity Track
Location :
Scaffold_80:213824- 215569
Transcript NameFunction/comments
Physo_120640GA22088-PA
Physo_109251predicted protein

Sequence
1745 bases(100 bases per row)
CTCGCAGAGGAAGGCGTGGCCTACCGCGTCGTGTACGTACAGCGCTCCTCCTGCACCTCCTAGTCCCACCCAAAACCTCACCCTTTTCCGCCTCAACATC
CGCAGAAACGTGCTCGGCAGCGGCTTCGTCAATGACAAAGTCAACATCGAGAAGCTCGCGCTGCTCGTGCGCAATGCGGACTACGCGCCCAGAGTACGCG
GCATTGTATTTAAAAATTATTATGCAATAATGGTGTAATTTTTAACTGTGGAATGGTTGTTTGCTGCAGAGCTTCAGCGCGTTGGTGATGCGCTTCCAGG
AGCCACGCGCGACTGTGCTGGTCTACAGGAGCGGCAAGGTGCGGCTTGCACGGGTGCACTGGCTCACAGAAATTGCGGTCTGTTTAGTTACATTGTATGG
TGTGTTGCTTGTAGTTTGTGGTGATTGGGGCTACGAGTGTGGACGACTCCAAGCTGGCAGCAGACAAACTGGTCTCCATTTTCAAGGTTGGTTTCGGTTG
TGTTGGGATACGAGGAGGCTATAAGCCTAAACCACTTGCTAATCTGTGGGTGTTTTTGTGTGTGTTAAATGTGCCGTGTTGCTGCAGAAAGTTTCGTTTC
CGAGCGACTGCAGCCCGTTCACTGTTCGCAACGTGGTGGGGTCGTCAGACGTCGGCTTTAGAATACGACTGGAAGGCTTGGCGAGAGACCACCTGCGCTT
CAGCACAGTGAGCTGAGTTGGCTATGCGTGTGGTTCCATGACGGGTATGAGTCTGATATGTGCGTGCTTTTGTACCGCAGTACGAGCCGGAAATGTTTCC
AGGGCTGATTTACCGCATGCTGCGACCCAAGTGTACTTTACTTATCTTCATATCGGGCAAAATCGTTATCACGGGATGCGAGGTACAGCAGAAGAAAAGC
TCTCATGATGTTTGGTCAGACCAGTTCATTCACTGACCTGCGTTGTGTTTTCTATTGTTGGTGCAGTCCCCTGCACAAGGGGAGAAGGCGCTGGGTAAAA
TATTCCCCGTTTTGCTGCAATATCGTCTACGTGACGACATCTCCAGTGACGAAGACGAAGACGAAGCAATGTGATGAAGACTACGCCCTTATTTAGTAAC
TGCGAGCGATTATCCCAACTTACAATTATCTGCTACTGCGCACAACGCTTGCTTCGTTCTGCACTCCAACGCAGAGTTCAAGGACTCTCAATGCCATCGC
AGACGCTTCGAGCAAGCTTTTTCGCCTCGGCGGAATCGGGCGCCGTAAGTGAGTGGTGGGCTCACGCTAAATAGTTGTACATCTGGGCGTTGTTTTGGTC
TCGCTCCAGATACTCTCGGTCGATGAGACTTTCGATACGGCGCTTGATGTCGGCAGCCTTTGCGGGGAAACGAACTTGCGTGAAGATCTCCGTCATCAGC
AGCGCGTGCGACAGCTTCTTGCGCGCCTTCATGATACGCACAATAGCTGCGTCCACCTGGTACTGGCGGTCTCGGAACACACGCTCGTGGGTGTCTTCGT
TCTCCTTCTTGGTCTCCTTCATCTGGATCGAGTTGATCTTGATGCGGATGAACTGGTTCGTGAAGTTGCTGTTAAATACAAACAAATCGTCGTCGTTCAC
GTCCTTGCCCTTCGGCACCTTCTGCAACACGCGCGTTTTACCGCATGCGAGCGACTGCAGGGTCCGTCGAAGCTCGCCATCTTCAATACGCGTCTGCTCC
TTGATCTCCTTGAATCCCAACGAATCGGCTCCGTTGAAGCAAAGC