Description :
From Genome Similarity Track
Location :
Scaffold_60:213820- 217675
Transcript NameFunction/comments
Physo_138103reverse transcriptase

Sequence
3855 bases(100 bases per row)
GGCACTCTGGTTGAACTCATACAGAAGTGCACCACAGTTGAGCTGGGTTACTGGCAACCATTCCGGATCATCGTATCCTTTCCACTTGACCTGGTACTCG
CAAATTTGCTTGGATGTGCGAGTGCGCTTGGTCCACCGGAGGTCCAGAATCTTTTCCACTTCATACTCGTCATTCTGTTCGTCCGGCTCCCAACTGTCCT
CAGGCAACAGCGCCGCATCGAAATCGTCATCGTCATTCAGTTCGAGCTCCACCGTGGGTCGTTTCGGGAACAACGCTCGAGGCTTGAGACGACTGATGTG
TACCCACGGGTTGACGCGGTATCCTGTGTCCTCCACCTTGAGCTTCACGCGGAAGTCGTCATGGACCTCGTCAATCCTGAACGGTCCGTGCCACATGTGG
GCCAACTTGCGGCTCAATCCTGTCTGGACCTTGGGGATGTAAAGCCACACCGAATCTCCCTTCTCGAATCCGGTCTTCAATCGTTCGGAGAGTTCTTTCC
ACTTTCGTGTCTGCTCCTCAGATCGTGCCCGTTTCGCCTGCTCGGAAGATCCTCAGCACATGCAATCGCGTAACTGTAGTCGCGCTGACACTTCCGACGC
CACTCGTACGCTGTACGCTCGGGCACACTGGATGGTTTCGGTCCCAGCATCGCCGACACCGTTCCCTGTGCGTCCCAACCGTGTACCAGATAGAATGGTG
CATCCAGTCTGGTCGCGTCGAAAGAAGTATTTAGTGCAAAGATCAGTCGTTCTGCATGGTAGATTGGTCTGCCTCGGCAATGTAGGCGCGGACGCTCCGA
ATGGCGGTCTGGACGGACCGCTCCTGTTGGCCGTTCGCCTGAGGGCGATTGGCCAAGGTCGCGCGTTTCGGCTACCCAACAGCTCCCGAAAACGAGTGAA
CACCTCACTCATGAAACGAGGGTCCTGATTGTGTCTGATCATCGATGACGCACCGAAATTCCGAAAGACTCTCTCGTCGTACGCTTCAGCCACATCCTGT
GCCGTCGTAGACGGCATGGGTTTACACATCACGTAACCAGAGAATGAATCTTGGAACAACAGCAGGAAGGTGTTTCCCCGCGCTGACTTGGGCATGTGCG
TCACGAAATCCATAGACACCACTTCGAATGGGCGTCGAGGCTCGATGTTACCAGGCGACGGTCCAGGATTGGGAGGTCGCCCCTTTCCGCTTGCACAATC
GACACACTCTTTCACGAAACGTTCGACATCGGCATACACACCGGGTCAATAGAATTCGGTCCGGAGTCGTTCGTGCGTGCGTGTGATGCCTTGGTGTCCA
CCTTGGAAATCCTCGTGAGCGTAGTGCAACAGGTCGGCGTACAGAGTCTGGGGCACCACCAGGCAAGGTTCATCCTGTACGTCCCGAGGTCGGTCCCGTG
TGGAACGCGCGAGTCGGTACAGAACACCCCTGGCGTCCAGCGCAAACAGATCGGAGAGCTTCGCAATCTTCCGTAGTCGCCTGGGAGAGAATCGATCCAG
GTCTCCACTCAGATACGCTCTGACTTCTGCGATGAACTCATCCTGGTCCTGGAGCGCCTTAATTCTTCGCCACCGTTCAGCTTGGAACTCCAGCGGACCC
AATGGCTCGCTGGATTCGGTCTGCTCCTGGGTTCTCGACCGGGTTAAGACCGCCATGACTCGAGCACAGTTGGGTAGCGGTGCTGACCCAGGATCCTGTT
CGGCACTGTCTGGTGTCACCTCATCCGGTGTCGCTGCTGCCTCGGTCGCATCTCCATTCGGTACGTCTTGACCAGCTTCGGTTACATCCGGTGTCACAAC
AACTGGCTTCATCAGCTTCTCATGAATCTTCGATACTCGCTGCAGGTGGGTTCGCTCCTCTTCATCCCGTACGGTCCACGTGGCACCAAGCGCTAATGTC
TTGGAGGTTAGGTAATCCGCGGCTAAGTTGTACTCACGCTTAACGTGAACCAGTCGCAGCGTACCGAATCGCCCCTCCAGAGTTTTGCACTGGGCCAAGT
GTCGTTGGAGGTTGGGCTGGTTGCAATTGATCAGCCCTTGGACCTGCTGTATCACGATGCGAGAGTCTCCAACCACAATCAGGTCCGTGATACCACGGTC
AAGTGCGACTCCGCAATCCGGTCCAGATGCTCCCTGGGGGTAATCCCCGCACCCAGTATAGTAGCCAGACCATCTTCGTCCCGCTGGATGCGGCGAACTT
CCAGATCCCACTGAGATAGGGCGACGCCCCACGGCACACAGCAGCCATCCGCAGATTTGGACTGGATCACCCACTTGATTACCGAATAACGGGTGTACAC
AATCAACGGGCACCCTTCCAGGATCGTCCTGAACACATCCAGCACTCTCATGACCGCAATGACTTCCTTCTCCGCGGCGTGGTACCGAATCTCTGATTCA
TTCAGTACGCGCCCCGTGAAACGCACGGGCTGGATCAGTCCGTCATGCTCTTGTCCGAGGACCGCGCAGGCGGCCCACTTGTTTTGCGTGCGGGACGATG
ATGAACGGCTTGGTTCGGTCCGGATGTCGGAGCAACGCGGTAGACACGCTCTTCCGCTTCAGAATCTCGAACGCCTCCTTCGCTCTTGACAGGTCCCTGC
CGGCGCGCACCTGATCATCACTGAGCTCGTACAGAACTGCGGTCACTACCGGAAAATCTTCGATGAACTTGTGGTAGTAATTCAGACTGCCCAGGAAAGA
CTGAATGCCCTTCAAAGTGGACGGGAACGACAGATCCAGTACTCCCTTGGCGATCTTCGGTGTCGCTCGGAGCCCTTCAGCACTGATCTCGTGCGATAAG
TACGGAATCGAGCGCTTACCGAATTCGCTCTTCGGCAGACTGACCGAAATGTTCCAATACCGCAACCGGAAATGTAGTGCATCTAGGTCAATACACAGTT
GATCCCACGTAGGCGCCCCGTGCGCGATGTCATCGATGTACGAACTCCGTCCGAGGACAGGACCCATCTGCATCGGCGCCAGAATATTGCGCTGGAACAC
TGTCATCTGGTCCGTCAATGCAGGAAGTTGTCGACCGGACAGGATCTCCTCGTCAGATTCGGTACCGCTCAGCGCGACATTGTCGTCTTGCGGCTTCAAG
CCCAGAGAATCCAGTACGTCCTGGTCCACTTCGGCTTCCTCATCGGGCGGCGACCGAACAAAACACCACAAGCAATTCTTGAGCACCTGCTGGTAGACCA
AAGGAGCATTTTTCAGACCGAATGGCATGCGTCGCCACTGGTAGTGACCAAATGCCGGCACAAACGCCGAAATGAGCTTGGCTCGCTCCGTCATCCTGAT
CGCCCAGAAGCCGCTGGCCATATCCAGGCTCATCAACCACATCGCACTCTCGAAACCGATCAAAAGATCATCGATAAGCGGGAGCGGATAGTTGGACAAA
TGGATGAAACCATTCACAAGTCGGTAGTCGATGCACATCCGAATGTCAACTCCATTTTTCTTCAGCACGATCACGATTGGTGAAGCCCAGGGTGATGTGG
ACGTCTCGATCAATCCGGTCTCCAGCGACTTCTTCAGCAACTCGTACACCTTCATCGCGAGATGCGGTGCGATCGAACGAGCTCTCTGTGCGACCGGCTT
GGCATCTCCCACATCCAGATCGCAAACGACTCTACGAGCTGGGGCAGGTGCTGCATTGCCGTCGCCTAAGAAAATCCGCCGGTGGTACTTCAGAATGCCA
CGCAACCGGCGTTCATCATCCAGTCTGCTCACACCAGGTTCACCAACATCTGCTTTGTCAATGTCGCATTCGGGGCTCAGATCCTGTACCTCCGGAAGGA
GGGCAAGCTGATCTCGCAACTGCGACAGCAGATCGCTACCTTCGTGGATGTACAC