Description :
From Genome Similarity Track
Location :
Scaffold_23:213814- 216455
Transcript NameFunction/comments
Hyaar_Emoy2803810hypothetical protein
Hyaar_Emoy2803811hypothetical protein

Sequence
2641 bases(100 bases per row)
CAGGTGTGTCGATGGATCATATTCCACGCGGTCTTTGCCATGCCAATATGGAAACACGTGGTACAGCTTTTGATGCGTTATGCGCGTCGTTGAAATCAAC
CAGTATGCCCAGTGACGATGAGTTGCGATGGGTGAAGCATTATCTGGTGGTGAACGGTAAGGAGATCGGTCCTTCTGTTCGCATGAACACGCTGATTGGC
CTCAAGACAGTGCTGACTCGCATAAAAGAGACCCTCCGTGTCACGAGAAAAGATGTGACTGAAGAGGCCGCGGACAAACGTGACAATGCGGATATGCACG
ATAAATGTGTCGCTGCAGTCTCGTTTAAACATTGGATAGAGCGCTTTGTTGTCGCATCGATATACCCTGGTGCACTTCCTCAACGCTTGACGTTAGGTCT
AGAGGTTCTTCTCCTGTACATCCAGCTGTTCGGCGTTAGGAATGACGAGGCTGAAGAGCTTGCAGGAAGTTTTTTGCTCACAGGGCACATGGTGACGGCC
CTCCTCAATATGCTTACGAGCGCTTGGGACTCAGTTCGGTCTCTGGCGTTTACCATCTTGGACTTGTATCCAGACGACCTTCCTGGCTATTCTACGCGAG
AAGAACTCCGCACTTTTGTTGACTGGGCTGTTGGTCTTTGCGGTAGTCCTCGTCAGCGCGAAAGTGACGCTGGTGCTATGTTCATTCGGTTGCTTTTCCA
GAAGTGTAGCTCAGCCATTCAACGGTATGGGCTATCATTTCAGTGTACGCCGGAGCCACGATGCGGTGCTACCGGCGTAAACAGTGGCGATCCGGATGTG
GCTTTTGTATCGCAATTGACGCAAGTGATTCTTACTCGTGTCGAAGCTCTGAGTCTATCGGAAATACGACAGGGCAAGTCCCCACTTGTGCATGGCTTCT
TGCTGTCACTGCACTACGTTCTGGATAATGTGAGTTTTGAGAAGCATTCTGGTAGCAAAGCTGCGGACTGGTCGCGGGCAATGAAGCAGGTATTCGCGGC
CATTCACCAGTCCATGGGTGCATCCCTGGCTGTAGTCGGTGATGCCACTTCCGGCGCTGGTGACGAAAATCTGTCAGCTTCGTTTGCAGGTGTTGTGGGC
GAGGTGAGTACAGTGGCTGAAACTTCGAGCTCGGCGTTGCGAGTAGACTGTCGTGGTCATTTGATTGTCGAAGATGGTGGTGATCACGGAGACGATGACG
GTGGGAACACAGAACAGCGCGCCGTGGTTGGTAGCTGGCTAGCTGTTCGCGAGTGTGGCGCAATCATGGAATTGCTAATGCGGCGCGTACCGCTCCCGAC
CTCTAACCCGACGTCGGCTAGCGTTTCTTTGTTCACTGTTGACATGGCGCAGCTTGGAGGAGAAACGCTGCTTAACTCGCTGTTTGAACTCAAGCACAAG
GGTGCAGTCGCTACGGTATACCATGCATTTGAAGGTGTTTGTCGCGCGTTTCTTGCTCACGGTGAACAGAGTGCAGTACTTGGGAACTTGCCAGCGCAAT
GGGCGGATCGTTTATTGGACCGTCTGGAGCGATCAGAGCAGCATTTTATTTTGCGTCGTAGCTCAGGCTTTGCTTTCAGTTTTGTCGCAATCCTTCGTGC
TGAGCCGCGTAACTCGGCAGCCGTCATTTTGCCTAAGGTGATGTTGACGTTGCTACGTCTAGCCGGCAACGATACCGACGCTGTGGATAAATGTGAAACG
CACGAGGAACATCATTCACAATGGCGTGCTCGTGTGCACGCCCTGAACATTTTGAAACTCATTTGCCAGGACGGAGTATTGGCGGAAGACGTAGCTTGTT
ACGTTGTGGATATGTTCCAGCTGTCTGTGCGCGGGTTTGAATGTGGGTCATGGGCTGTACGCAACTCATCGATGATGCTTTTCGCTGCAGCCGCCCAGCG
TGTCATCGGAGATAAACGTATTGCTGATGGTAAAACTCGCCAACAAGTTGCCTGTGACGACGTGTTCTCGCGCTTTCAGCAGCTGCGTAACTTTCTTGCC
CGTGAATTGACTAGGCTGCTTGAAATTGATAGCGAGTCTAGTGGCACAAAAGCGGAAGCAGAACCGACTGGTCTTTACTCATTGCTTCTGTTTCTGAGCC
GCCTTCACCCTAACGACGACGATGACCAGCGTGTAGCAAATGCGCGTGTTTCGCCCTGCGATGACGAAAGTGGTTTAGCAAGCTTTGTCCAGCTTGTCAT
AAAATGCGCTTCGCAGTCGACAATGGCGATTCGGCACATGGCTGCGAAGGTCCTGGCTTCTATCGTACGCGATGCTGATGCTGCACCCGTTTTGTCTATT
CTCTGCACGAAACTTCCTCAAGGTGTCGTAAGCGCAAGGGACCGCCTTACTGTCTCGAATGCAATCCCGCACAATTTTGTCCACGGTGTGCTCGCTCAAA
TCCGTCACCTTACTCGCAAGTACTTGGTTGCCCGTGATGTGCGAAAGAAACTCGCTCTTGTTGCGAGTGACACACAAAGTGAAATTTTCGAGGTTGTTGT
GACCAAGCTGCTTCCATCAACAATGTGGCTGTGGACAGGTCAGGATGCTGGGTCACTGAATGCTGTCATCCGTGCAGAGCTGGTGGCGATTGTGGATATC
ATTGTGCAATTTTACGCACAAGACGCATCTAGTGCGCTTTC