Description :
From Genome Similarity Track
Location :
Scaffold_60:213800- 217667
Transcript NameFunction/comments
Physo_138103reverse transcriptase

Sequence
3867 bases(100 bases per row)
TGGAACCGGGCCTTAGCGCGGGCACTCTGGTTGAACTCATACAGAAGTGCACCACAGTTGAGCTGGGTTACTGGCAACCATTCCGGATCATCGTATCCTT
TCCACTTGACCTGGTACTCGCAAATTTGCTTGGATGTGCGAGTGCGCTTGGTCCACCGGAGGTCCAGAATCTTTTCCACTTCATACTCGTCATTCTGTTC
GTCCGGCTCCCAACTGTCCTCAGGCAACAGCGCCGCATCGAAATCGTCATCGTCATTCAGTTCGAGCTCCACCGTGGGTCGTTTCGGGAACAACGCTCGA
GGCTTGAGACGACTGATGTGTACCCACGGGTTGACGCGGTATCCTGTGTCCTCCACCTTGAGCTTCACGCGGAAGTCGTCATGGACCTCGTCAATCCTGA
ACGGTCCGTGCCACATGTGGGCCAACTTGCGGCTCAATCCTGTCTGGACCTTGGGGATGTAAAGCCACACCGAATCTCCCTTCTCGAATCCGGTCTTCAA
TCGTTCGGAGAGTTCTTTCCACTTTCGTGTCTGCTCCTCAGATCGTGCCCGTTTCGCCTGCTCGGAAGATCCTCAGCACATGCAATCGCGTAACTGTAGT
CGCGCTGACACTTCCGACGCCACTCGTACGCTGTACGCTCGGGCACACTGGATGGTTTCGGTCCCAGCATCGCCGACACCGTTCCCTGTGCGTCCCAACC
GTGTACCAGATAGAATGGTGCATCCAGTCTGGTCGCGTCGAAAGAAGTATTTAGTGCAAAGATCAGTCGTTCTGCATGGTAGATTGGTCTGCCTCGGCAA
TGTAGGCGCGGACGCTCCGAATGGCGGTCTGGACGGACCGCTCCTGTTGGCCGTTCGCCTGAGGGCGATTGGCCAAGGTCGCGCGTTTCGGCTACCCAAC
AGCTCCCGAAAACGAGTGAACACCTCACTCATGAAACGAGGGTCCTGATTGTGTCTGATCATCGATGACGCACCGAAATTCCGAAAGACTCTCTCGTCGT
ACGCTTCAGCCACATCCTGTGCCGTCGTAGACGGCATGGGTTTACACATCACGTAACCAGAGAATGAATCTTGGAACAACAGCAGGAAGGTGTTTCCCCG
CGCTGACTTGGGCATGTGCGTCACGAAATCCATAGACACCACTTCGAATGGGCGTCGAGGCTCGATGTTACCAGGCGACGGTCCAGGATTGGGAGGTCGC
CCCTTTCCGCTTGCACAATCGACACACTCTTTCACGAAACGTTCGACATCGGCATACACACCGGGTCAATAGAATTCGGTCCGGAGTCGTTCGTGCGTGC
GTGTGATGCCTTGGTGTCCACCTTGGAAATCCTCGTGAGCGTAGTGCAACAGGTCGGCGTACAGAGTCTGGGGCACCACCAGGCAAGGTTCATCCTGTAC
GTCCCGAGGTCGGTCCCGTGTGGAACGCGCGAGTCGGTACAGAACACCCCTGGCGTCCAGCGCAAACAGATCGGAGAGCTTCGCAATCTTCCGTAGTCGC
CTGGGAGAGAATCGATCCAGGTCTCCACTCAGATACGCTCTGACTTCTGCGATGAACTCATCCTGGTCCTGGAGCGCCTTAATTCTTCGCCACCGTTCAG
CTTGGAACTCCAGCGGACCCAATGGCTCGCTGGATTCGGTCTGCTCCTGGGTTCTCGACCGGGTTAAGACCGCCATGACTCGAGCACAGTTGGGTAGCGG
TGCTGACCCAGGATCCTGTTCGGCACTGTCTGGTGTCACCTCATCCGGTGTCGCTGCTGCCTCGGTCGCATCTCCATTCGGTACGTCTTGACCAGCTTCG
GTTACATCCGGTGTCACAACAACTGGCTTCATCAGCTTCTCATGAATCTTCGATACTCGCTGCAGGTGGGTTCGCTCCTCTTCATCCCGTACGGTCCACG
TGGCACCAAGCGCTAATGTCTTGGAGGTTAGGTAATCCGCGGCTAAGTTGTACTCACGCTTAACGTGAACCAGTCGCAGCGTACCGAATCGCCCCTCCAG
AGTTTTGCACTGGGCCAAGTGTCGTTGGAGGTTGGGCTGGTTGCAATTGATCAGCCCTTGGACCTGCTGTATCACGATGCGAGAGTCTCCAACCACAATC
AGGTCCGTGATACCACGGTCAAGTGCGACTCCGCAATCCGGTCCAGATGCTCCCTGGGGGTAATCCCCGCACCCAGTATAGTAGCCAGACCATCTTCGTC
CCGCTGGATGCGGCGAACTTCCAGATCCCACTGAGATAGGGCGACGCCCCACGGCACACAGCAGCCATCCGCAGATTTGGACTGGATCACCCACTTGATT
ACCGAATAACGGGTGTACACAATCAACGGGCACCCTTCCAGGATCGTCCTGAACACATCCAGCACTCTCATGACCGCAATGACTTCCTTCTCCGCGGCGT
GGTACCGAATCTCTGATTCATTCAGTACGCGCCCCGTGAAACGCACGGGCTGGATCAGTCCGTCATGCTCTTGTCCGAGGACCGCGCAGGCGGCCCACTT
GTTTTGCGTGCGGGACGATGATGAACGGCTTGGTTCGGTCCGGATGTCGGAGCAACGCGGTAGACACGCTCTTCCGCTTCAGAATCTCGAACGCCTCCTT
CGCTCTTGACAGGTCCCTGCCGGCGCGCACCTGATCATCACTGAGCTCGTACAGAACTGCGGTCACTACCGGAAAATCTTCGATGAACTTGTGGTAGTAA
TTCAGACTGCCCAGGAAAGACTGAATGCCCTTCAAAGTGGACGGGAACGACAGATCCAGTACTCCCTTGGCGATCTTCGGTGTCGCTCGGAGCCCTTCAG
CACTGATCTCGTGCGATAAGTACGGAATCGAGCGCTTACCGAATTCGCTCTTCGGCAGACTGACCGAAATGTTCCAATACCGCAACCGGAAATGTAGTGC
ATCTAGGTCAATACACAGTTGATCCCACGTAGGCGCCCCGTGCGCGATGTCATCGATGTACGAACTCCGTCCGAGGACAGGACCCATCTGCATCGGCGCC
AGAATATTGCGCTGGAACACTGTCATCTGGTCCGTCAATGCAGGAAGTTGTCGACCGGACAGGATCTCCTCGTCAGATTCGGTACCGCTCAGCGCGACAT
TGTCGTCTTGCGGCTTCAAGCCCAGAGAATCCAGTACGTCCTGGTCCACTTCGGCTTCCTCATCGGGCGGCGACCGAACAAAACACCACAAGCAATTCTT
GAGCACCTGCTGGTAGACCAAAGGAGCATTTTTCAGACCGAATGGCATGCGTCGCCACTGGTAGTGACCAAATGCCGGCACAAACGCCGAAATGAGCTTG
GCTCGCTCCGTCATCCTGATCGCCCAGAAGCCGCTGGCCATATCCAGGCTCATCAACCACATCGCACTCTCGAAACCGATCAAAAGATCATCGATAAGCG
GGAGCGGATAGTTGGACAAATGGATGAAACCATTCACAAGTCGGTAGTCGATGCACATCCGAATGTCAACTCCATTTTTCTTCAGCACGATCACGATTGG
TGAAGCCCAGGGTGATGTGGACGTCTCGATCAATCCGGTCTCCAGCGACTTCTTCAGCAACTCGTACACCTTCATCGCGAGATGCGGTGCGATCGAACGA
GCTCTCTGTGCGACCGGCTTGGCATCTCCCACATCCAGATCGCAAACGACTCTACGAGCTGGGGCAGGTGCTGCATTGCCGTCGCCTAAGAAAATCCGCC
GGTGGTACTTCAGAATGCCACGCAACCGGCGTTCATCATCCAGTCTGCTCACACCAGGTTCACCAACATCTGCTTTGTCAATGTCGCATTCGGGGCTCAG
ATCCTGTACCTCCGGAAGGAGGGCAAGCTGATCTCGCAACTGCGACAGCAGATCGCTACCTTCGTGG