Description :
From Genome Similarity Track
Location :
Scaffold_76:2138- 6592
Transcript NameFunction/comments
Phyta_totarag3009hypothetical protein

Sequence
4454 bases(100 bases per row)
GTAGTGACTGATTCCTTACAGAGCGTGGTATATGTCTTGAACGCGTCCGACACCCAGCGACCGTGGAACTGGATAGTGAGTGCGTCTGTACCTGAACGAT
ACATGTGCGTCGCACCGCCGGAGCGAAGGGAGTGGGAGCTGAAGCGGCGTGGATCTTTGCCGGTCTTGATGGCCGCACGCTTGATGGCGTCTGCAACGTC
TGCAGTTGATATGCACGCTGGTTTCCCCCCGCGGGATATGTACACCGCCGCTGGAATACCGATCGGGAGGTTCTTCTGAGCTTGGAGGAGAATCAGGGCG
CCAAACACAGGACACAGGAAAGGGTGTCCGGACCGAGAAAGCATTCTTGTCGTAGGTTCTCCGCCTTGGTTTGTCTTGGAGCCGACCAGACGCAGACACA
CCGACTGTGCTAGCTGTGGAGAACGTGTTGGCTTGCCCGCCTCGTCCAGAACCACAATGACATGGGCTCACACGGCAAACCATTTGAAGGTGCGACTGCT
GATCGCCACGATCTCTGAGCGCCTCAAGAGAAAAAAAGAACGCCAAGCACATCCCCCCCATAGGGCTTGGTCGAAGGGAGCAGTGAACGTGAGGCTATGG
AAGCAAGCTTCCAGTAGCTCAAGAGACACAGGCGCCTTGTGCTGCGGCGGTGTATCGAGGCGGTTGATTCATTTGATCACCATGTGAATGTGCGGGTGTG
TGAGCGGAAAGTCGTAGCCACTTGCAGCGAAGAAGTGTCGAACCCCTTGAAGAACTGCCATGATGGATTCGCTGCGAATAGGTCCACCGGATCCGAAGCT
GAACTGGAAGCCGTGGAGGGCGAAGTCCGATATGAGTTGTACTTGCTCGGTGATTGGCATGCCGGCAAGCCAAGCTGGGATACTCCTTCGTGATGTCCAC
GCGAAACATTTGCTCAGAGCACGCCTGTATTGGTCAAACGTGGAGTCGACAACGGAGTGAGCTCGGAGATACGTCGCCAGATATTGGTCAGGCCTTGTAT
ATCCACCGCTGGTGAGACCTGCGACCAACCCGGCGTTAGTGAGGCAAACAACTGGGTATAAGATGAGTTAGCCGAGATGCGGGAGCCGGCGTCTGCGTGA
GCATTATCAGCGCCGGATACGTGTGAGGCGGAGAACCGGAGATGAAACGACGTTTCCCACCAGCTAAGAAGCCGAATAATCACCTGAGCTCGCGGATTCC
GGGAGGCCAGCTTATTTTGCCAGGTCAAAGCGTTGGATGACCAGCGTGAACCCCATGCGTTGACAGCGAAGGCGCACGATAGCAGTTCACGGAAGTTGAT
ATCAAAGCCGTTGGCGTCACCACTcttgaactcggcgatgCGATTCAGTTCAAACTGGGAAAACGGGTACGTGAGCGCTTCCTCGGAGGAAACGTCCAGC
GCGCACAGCCCAAAGTCGGAGACATCCACTTCGATGACAGCGCCCGGAGCGGGTAGCGTGTTAAAGTATTCCAGCGAGACGCCGTTCAAGTGAGTCGTGT
GAAGTACTAACCACCACCATAGTAGATCTTGCTTCATGTCGCCTGTTACGGGTACGCGTTCGAACCGATGAAGTTGACTCTCATGCACTCGCAGCCGATG
AAGGAAATGTCGGGCGGCACGGGTCCAGGTAGCCACTCCCCATCAGCGATCGATATGCCTTTCGTGTGAGGACTGTAGCGAGGTAAGCAGTAGCCACAAT
ACGGCGAGCCATTTCAATCTTCCCGGTCGGCATAGAGACGCGCTCCTCAACCGAATCGAACTCAAGCCCGAGGACCCGTTGGCGTGTTCTCCAACTTGTG
AACTTCTCGTCATTGATAGCCTCGGCGCCCAGCACAGCTACCACGGCAAAACGAAGAGATCGATCAATATCGCTGCACGATGTTCCAATATCCGCTGTCA
CGTTGATATGGTCGTCGACCCAGTCATAATTGAAACATCCGGTGAGGTATGCGTCGTTGGTATGGCTGCCATGGACATGCGAGATGGCTCCACCGATGAT
CTCGTAGAAACCAGGTGAACCCGTCCATCCAAACGGTGCAGCCAATTCGATCACCAGTACATTCTCCTTTTCAATAAGCCCGGTAAAGAGGTAGACATGA
TGGCTGTGGACACTGATGTTGCGGAAGGCCGAAGCAACATCTCCGGCCATAATCTGGATTTCGGCACCAGGGTGAAGCTTCTTCGCTCGGATTATCTCTG
CTGCAACGGCGTCACAGTGACTGTAGTCCGGTCTTGTGATGCTATCTTGATCGGTGCAGTCATTTATTGAGGATCCTTCAGGGTACGCCAGGTCATGTAT
CGTACGGCCTGAGCAACTGGCATCTTCACCGTCCTTATCAACCACCCCAAACGGGCTGATAACAACTTCAGGCCACTGGTCAAGCAGGTCCATATCCAGT
ACGAGGCACCTCCCGGCATCTTGCTCCTTACAAATATTCTTGCGAAGCACATTGATGCGGTCTCGTGCAGACCCGTGATACGAAGGGCGCTGCACctgtg
gtggcggcggttCTCTAAGGCGCACTTCCACCCCTTCGCGGACCATTTGTTGAAGCTGGTCGAGGTGCTTGTAATCCTTGCACACTTCGTTTAGCACTGC
AGGCACTAGGTTCTTGTTCGGACGGTAGTCATCCACTGTTTCGCATCGAAATAACTCCACAAAGGCTGGCAACGAAGCGCCAGACCGACGCGCGTATTCG
GAGAGCGCATGCTTGAGTGGTGTATCCAACAGGAACTCCGTCCCGGCTTCGGGTTGTCGAGACTTGGAGTGAACATCATCTGGGAGCGTAACGCTCAACT
TCGACATAGCGTTGGCCAGCGTGACCCTTCGAGTCTGATGTATCAGATCGTGTCGCGAGCGTGCGTTAGCGCACAACTTCGCCGCGGTTGCTCGACTGAC
GACGGGACGCAGTGACCTTGATGGGAGCTCGCCACGAACACCGGAATGATTTTTACGTGAACACTCTTGGCTCACCTTATTACAGCCTCCCTGCTGTCAG
TCAGAGTGGCACGGGGTTTCTAGTGCGACTAGGGGCTCTAAGCCAGGCTTCGAGGCAATGCTAGCGGTATTACTATCGCATACATGCCGCGTTGAAGTTA
GCGACAGCTCGCCCGTGAGGCTAGGCGACAGGTGTGTATGTGCCGGCTGTATGGCCGTGGGCGTGGGTGACTGTATGGTCGACCCGGACCGTAAGGTCAA
AGGTGGCTGTGCAGCCAAGCCATGCGCGGCGGCTGTACGTTGAAGACCAGTGCCATCGTAGATAGTATCCTGCTGGCGGTCTGCGTCGGCGGGGGATGTA
GTGTCCGGAGGTGCCGGTCGAAGGGAAAAACAGGTGCCCAGGCAGAAATTTCCTCGCTCGCGCGGCAAATCGCTCTAACTCCATCCGCCTCCCCGCGACT
TGGGCTTCGCACAGAGGGCCCCAActccagcgcagcattgTAGTAGCTCGTAGACAGATTCTCAGCAGTACTTGGTGTATTATTCTGCTTAACCTGGGTC
TCGAACCGTAGGGACGTCGAGCTGCCATCCTCACGGCACCATCAGCGTCGATCAACTTCGGTAGCTGCACGGCCGCGATAAGTCTCGTCGACCCACTCTT
TCACGCGAGCGGGTAGCGGCTCAGTCCAGTTGTGCATGTGGCGAGGATTACCGCAACGATCACGCGAGCCACAGTTGCAAGGAAGCCCGGCGACGTTCAG
CAGACATGGCTCCAGGCCCTTTCGGTTGATGGGGGTGAGACGGCGGATGCTGTCCGGAACTGCCGACCGACGACGGCTGTCCCGTCCCGTATCGTTGTTG
CGGTGGCCTCTTCCACTGCTGTGACGTCTCTCATCGTCAGTCGCTTGAGTCAGCCCACTAACCAACGCCATCGTCCACGCGGGCGACTGATAGTCGATAC
CCCCTAGCGCCTCGCAGTAACCACTCCACCACTGGGGATCGTCAGCTTGCATGTGGGCAAGCGCGGTCCCCGTGAAATTGTTCGTGTACTACAACGTAAA
GCGTACGCGACTGGCGTGTTGGCGGGGCCTGTCgacttgttcttgtccacaAACGCGCGCAGTCGGGACGTGAGTTTTCGCATGTGCCAGCGCGCTCAGA
CTGTGGATGGCGTCGAGGATATCTTCGTAAGAGCTGCAGCTTATCGTCACCGCTGGCAAAGCAGCCGATGGGCTGCAGTCACTCGAGAAGTTCGCGTTCG
ACGATCCATCCTTAAATCTTGCCATCTCCAACGACTCCTTGAAGTGCATGAGTGTCAGGCCGCGCGACCCGAACCGATCACTGTAGATTGCCATAAGCAC
GGCGGGTGTTGCCGGAAACTTGACGCACTCTAGCTCCCGCATTCACAAAACAAACGACATAGCAGACAGGGGTTTACCTGTGTCAGTTCCGAATGCGCGG
AACATGCTACTTGCTGCTAGCAAGTGAGCCTGCGGCGGGTTGTAGTCACCtttt