Description :
From Genome Similarity Track
Location :
Scaffold_22:213799- 221717
Sequence
7918 bases(100 bases per row)
ACTTCCTCTTGCGCAAGATGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACCTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGAAGGCATCTTCGGGATGGAGGCCCTGCAGAGCC
TGATGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGAAGTAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAGGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGAAGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAAT
GAGCACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTCGAAGAGGCGATTC
AAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGATCCCGGTCGAACAAGCCCCGA
CGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACGTCCGCTGCTTCGGCTGTGGGAAGATGGGCCATTTCAAGCGCGACTGTCCCGCGGAA
AGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAATAGGGGCAAG
GCGCCCTACTGGGGAGGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCG
AAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCACTTTAGAATCTTGATTGACTCTGGGGCGTCAAAGAATTTCGCAC
GCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCAAGGGCAGCGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCTGCCGCCCTGCGCAGTCCGACAGAGCATTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGTTGGTGGCCGCGCCCAGAAGAGGCGCTGACCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCT
GCAGCTGTAATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGATGTCGGATACGCTTCCTGTG
TGGGTAACACAGCGCCACAGGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTATCACACGAGGCCAC
GAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAACGACGCCGCCGCCGCCTCAAGTCG
GATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCG
ATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTC
TTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGGCCACTCAGGAGGAGCTGACCTCCTCCTCTGTCTTGGACGAG
AACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATG
CGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAG
GCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTATTGCTTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCG
ACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCC
CACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCAAGAGAGTGA
CATTTCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTTATGCCGCAGGGCCTGTCTAACGCCCCGGCGACGTTCAATCGCCTG
GTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGG
TGCATCTAGGACACCTCCGTCGAGTGTGGGACGTGATGCGAGCGAACAATCTCTACGCTAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGT
TCTCGGTTGCTTCGTCAACAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGA
AAGTAGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGGCTGGC
GCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGT
CGTCTGCGATGCCTCCAATTACGCCATCGGGTGTGCATTACTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAA
GCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGATCCTGGCAATGAAATATGCCCTTGTGAAGCTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTG
TGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGTTGTCCTTCTTCGCGGAATACAACTT
CCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGAT
CTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCT
CGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGGAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGTGTGGTTGTACCCAA
CGACGAGGATCTGAAGTTCGACATCCTCGCGAAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCC
TTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTAC
AGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCTACGGACACGGCAACACCGGAATTTTGGTGTT
CGTGTGTCGGCTGAGCAAGATGATACAGCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGCGTTCCGCTAT
CACGGTCTCCCGGAGATGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGT
CCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTG
GTCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTATACTTGAACGGCTTCCGCCACCCCAGA
GTGCCTCTCACTCTTCGAAGGGACACTGACTCCTCTATTCTAAGTGGGGGAAAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTT
CGCTGCGGAAACAGGTGGAATCCTTGATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTA
CTCGGACAAACAAGAAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTC
GGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGC
ACGCGACGTTCTATGTCGTACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCG
GTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAAC
GGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGTCGCGGGCGGCTCCGGACGTGGCAACAA
AGCCTCGATCCGTAGAATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAAGTCTCGCGACCTCTCGCTCCAC
CAGGTCCAGGCGGCCCGCAAGACAAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACG
AGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGT
ACTCGTACGAGGGCACCTCCGGCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGTGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGAC
AGCTCCTCGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCGTGAGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGA
ACAGAAGCGGCAGCAGCTTCATAAGTAGTCCGGGGCTTTTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAG
AAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTG
CTGATCTTCATGGAGTTCCCATAACTCCGTGGGTGAGTACTTAAGAGACTCCACTCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTC
TCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTT
GCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAAGTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGTC
CACAAGGCCACGAGGAGCGACGAGAAGCTTTAAGAAGAGGTCAGGCCCAGAGCAGCTCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGG
CTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAA
TGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAG
TGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGA
GGATTCTCTTCCTCATCGCCACCGGCTTTGGAAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGAT
CACTAGCGGGCGACTGCACGCTACCTACTTTGGGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTC
GGCATCGTCTTCACTGCCCGAGCTGAACTCGCGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCG
CGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGAGAGGCTCCGCTGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTACTGCTCT
TGGCCTGCGCCTTACCGGCTGCAGCCCTTGGGAGCGTGTCTTTAGCACCGCTCTTAAGTAGTGCCCACGAGGCCAAGTTAACGGTCGGAAGGGGAGGACC
TAAGACCGAAGAGCCGCACAGCTTGCCTGCTTGAGGCTCTAACTATGAAGGGAGCCTCCGCCCGGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAG
AATGAGAATTTGTGACGAGCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTTAGTGGGGGAGGGTGTAACGGGGTACGTAGCCCTCAGTGTACCCT
GGTTACATGAAGTGTGACACTTCACACTTCAGGAGATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAACGTCGTTCAAAGCCAACCATTGGT
TAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCGAACTTATCCTACCTATAAATATACTCAGTTTACAATCTACCCTATTTAGGT
CACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTG
TGACCCCGTCACACTTAA