Description :
From Genome Similarity Track
Location :
Scaffold_56:21375- 22950
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09854sporangia induced Bardet-Biedl syndrome 4 protein
Sappa_CBS223.65SPRG_09855Hypothetical protein

Sequence
1575 bases(100 bases per row)
AGTTTGTGGATGAGGTAGTTCTTGGCCGTCATCGGCGGCTCCATCCGCGGGGGGCCGCGCGCGCTCAGCGGCGAATTGGTATCGTCCACGTCGCCCATTT
CGACTGCTGCAAAGTGAAACCCTCGAGCCACCGTTGAGAATAGTATACGGACACGAGAAACGTCCATCCTCGTCGGCAAGCGCCAGATAATGAAGACCGT
TGCTGGTAGTGTGTAGCTACCGTTGGATGTGTGACAACGGAAGTTGAGGGCCTTGGAAGATAACATAAGACGGTGTCCATGAATCCACTGCGACGCGGTT
GCGATGGAGACGACCATGAGCTCCACCGACCAGCCAAGTTAACGCCAGACCGACAACGTTGTTGGGGAATATCTGGCCCAGCACACGTTGGGACTGCGAC
CGTAACGCAGTTGTGAGTTTGAACACAGAAGAATGATCCATGCAGGGGATGGTGGTAATCGCGAAGGCGGTGCAATCATGAAGCGTGTTGTGCGCCTGCA
ACTCTAGTAAGCAGACTTTTTGGACGCAGATGCCACCCTCTACCAGCTGCGTGAGCACGATGCAGTCGCGAGGTAGTGTTGCGACTCGCTACCAGCATCT
GCGCGAGTTGGAGCGCAGCTACGTGAACTCTACACAACCGAGATTATCGATCCACCGTGTCAAAGGCGTGTAAGCCACCAATTAGAGTAGACAGGAGACA
TCGAAACGTGGGAATATACTTGTTGCATACCAAAGAATACACCTTTTCAATGCAGTACGCCGTTGAGGCTGATGAAGCTCATGCAGCAATAGTACTGCCG
GCGGTCCTCGGGGATGTCGGCGTCGCCCTCTTGCTCGTCGTCGTCGAGCTGATATTGGTGCTTGCCGTGCAGCGAGAAGCGGACGCGCCATGCCAAGTCT
TGCAAGAACACACACTGCGGCAGCTCAAAGCACTGCAGCTACAGTACGACTTTAGTTGCGTCCACGAAGAAGAAGAAACATCGTCGTAATACCTCCATGG
CGTTCTTAATGTCGTACCGCGGTGACGAGTACACGACCGCGTCGGCCGTCGACAGGATCGACAGCGACACCTGCCGCGGTGCGTACGTGGGCTGCCCGAG
TTGCCACGACGCGCGGTAGGGCACGATTTGCAGGCCCTTTAGGATGCACGAGCCGCGGACCATGTAGTCGATGAACTCGTCGCTGTTGGGGTCGCGGCTT
GGCCCACTAGTGTGAAGAGATGGTCTCGACATCCATTTGATGTAGTAGTACCTGCTCCAGTAGCACTGGCCCATCGAGCAGCCGCAGACCAGCCTACACA
TCGGCCGTCTTTAGCAAGCAGGTTGGTATTGCCCAGCGATCTCAAGTCGCACCGTTGAATCGTATAGTCAAAGAGCGACCTGTCGTTGGCAAACTCGCGG
ACGCCCGGATCCTTGTACTTGACCATTTCGCGAAAGCAAAGCGACGGATGGAGCGTGTTGTCCGCGCTCTCTTCCTTTTCGCGGTCGACCGACGAGTACC
CTAGTTGCATGGCATGGAACCTCGGCGCTTTGGACGCCGACGCCTACCGGCCACGTCGTGGAGAAGCGAAATGCT