Description :
From Genome Similarity Track
Location :
Scaffold_3:2137408- 2143322
Sequence
5914 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCATTCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGGATG
GAGCAGTTCGCTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGTCCTTGTTGGGCCTGGAGGGCGTGACGCAACTTGCGCAGCAAGGCC
CCGACGCGGTGAACGCGCGTCTCGAGGCGTTTTCAAGCTACGAGAATGCTCTTCTAGAGCACCTCCAGCAGAGGATGGCGACTGACGCGGCGCCCCAAGC
GCCCCCTTCGTCGTCCGACGCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGAAAGCTTGATGCTTTGGACC
CGTGAGGTTGAGATGGCTATGAGCTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGG
CACTAACGTCCGGGATGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCTCCGCCTAACGAGGCGTATCG
CGTGCGCTCACGCTTGCTGGCGACCAGGCAGAGCAAGAAGGAGTTGATGGACTATATCCAAGAGTCGAGAACTCTCATTGCTGGCATGTCTGCGGACCCC
TGCCGGAAGCAGTCACCGTTACGGTGTTCATGGAGGGCCTTCGCACTGGCGTTGCCAGGATAGAGGTGTTCCGAGCCCACCCGAGCTCTTTTGAAGAGGC
TGTAAACGTCGCATTGAATGCGGAACACAACTTTAAGTCGTCGAGACTTGAGTGGAATGCGTCTTACGCTAGCGTGTCGAGTGGTCCGGAACCCATGGAC
CTCAGCTATGCTGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGTTTCATCTGTGGTGACACCCGTCACCTTCGTG
CTGGGTGTCCGCTGCGCCATCAGAGCCAGGCTTTGTCAAGCCGCTCTTCGAGTTCGAGCCAGTGCTCTGGTTTGTATCGGGGAAACGAGAAGTCCCAGTA
GGCGCGGGTAGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGACGTACGCTCTAACC
CGGAACGTGTATGCAAGCCGGGCTTGCTAGTTGTCGAAGCTTGGGTGAGGGGCTTCACGAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAA
CTACGACCGACGTTCTACGATTGACGGAAGTCAGCTTTATGCTGAGGCGCTGATAGCGTCACTGTTCGTCTCGCGACGGGCAGTCGTGTCACGGTGCCTA
AGGTCCCTGTCGACCTGGGCGTGAAGTTTTTGGATTTCGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTTGAGATATGATCTCATCCTTGGTAT
GGTGTGGCTGGAATGCCACGAGCCTTGGATCGATTAGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCGTTTGCGAGTCATGAACCC
ACCTCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACTGGACCGAGTCGTTCAATGTGCTGGACATCGGAGTCTCCGAGTTGGTGAATACTGAGTGTG
TCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGCCAGGTGGGGCGGCACGAATTCCGCTGAGCGGGTGTGCGTCTGAGGACGACGCCCTGCTGTATTC
AAGTGAAGACAAGGTCGGCATGAAGCCGAGGAGCCATTGGCGCGGACCGGCCGTTGAAGGATGTGGAGCGGCCCTAATTCCGCTGAGCGGGCGGGCGTTG
GAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCACGGTCGGCACGATGCCGAGGAACAAGGGACTTTGCCCGGATGAAGGTCGTGGAGTGGCACGTAATC
CACTGAGTGGAGGCTGCGGGTCGTGCAGCTCTTCGCTAAGTGTCGGTAAAGACACTGGAGCTCCCCTGAAGCTGAACGAGGTGGTGACACCTGGCGTCAA
GACGCACGCGAAATCACGGAGCTCTTCGGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGCGATC
TCACGAGTCGAGAAGGGCGTGTCGAGCGGTGAGGCTCCACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGTGACGGGCGACGTCGACGAAGGTA
TCAACCTCGACGACTTGTCCTCACTGCCTGCTCTCCTGGAGCTCCTTGGCCGAGTTCGGCGGAGCCTTGAAGGCTGGAGACTTGGCCGAGGTAGTGGTCA
TACGACCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAACAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCT
GAAGGACCCGTCGGATCCCTTGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGA
CACGAAATCGATCTCGTTCCGGGAACAAACTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGA
AGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTT
CAACAAGCTGAATGCCGCTACCATTCCGGCGCAGACGCCGATCCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGCTGTACGGTGTATAGTGCGCTC
GACTTGGTCGATGGATATTACCAATTGCTCATGAGGACGAGCGACATTCCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGA
TGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTAATCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATGACAT
TTTTGTCCACAGTCGTGCGGAGCACAGAAAGACTGATGTGGAGAACCATGTGGAGCACCTGCGTGTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACG
CCAACATTGACAAATGCATCTTCGGAGCGGAAGAGATCCCGTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCAGGTTAAGGTCAAGG
CCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGAATCTTCGCAAGTGGCTTGGCTTGGCCAATTAATTGCACAAGTACAGCGAGAACTACGCTGAGAT
GGCTCGGCCACTCTCTAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGGACACCGAGCATCAAGATGCGTTCGCGTCCATTAAGGACAGTCTCCTGCAT
GCGCCCATTCTGGCTTGCCAGACCCCGCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGGACGTTGCCATCGGCTGTGTACTGCTGCAAGCAGACGCCGA
GGAGAGCGTGGTAGCGTTCGAATCTCGCCAACTGAAGGCTGCGGAGAAGAACTACGCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTC
AAGTTCAGGGTGCACATGTTGGGCTCTCAGTCGTTCGTGATTTACACCGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAATGGA
TGGCCCGTTGGCTGTCCTTCTTCGCGGAGTGCAACTTCGAGGTGAAGTACAAGCCTGGTAGGCAGAATGTACTTGCGGACGCGCTGTCGCGCAGGCCAGA
TTATGAGCTGGCTCATGTTACGACCGTGACTTCGTCATTACCGGATCGGATCCGAACGGCTTATGCCAAGGACGATACTTGTGTCGCGTTGCTAAAGGCG
CTGGGGAGCAAGGAGTTTCAAGCCTCGAACATGGAATTGTCAGTGCGGATGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACA
ACACTGGCCCCGAGGATACGCCCCGCGTGGTCATCACTCATGATGAGGATCGGAAGTACCGCATCCTCTATGAGGTGCATGACACGCCGCTGGCCGGCCT
TTTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGTGCACTCATGTGCGCACGTGCGAGACGTGT
CAGCGCGTGGAGGCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTTTGCGTGTCCCTTCGGGCTGTTGGCAATCCATGAGTATGAACTTTGTGTTTGGCC
TGCCGGCGGAAGCGGCGGGCAACACTGGATTCGTGGTCTTCGTGGACAAGATGGCTCACATTTCGGCTGTGACGGATACCATTGATGGTAAAGGTACAGC
AACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCATCACGGGCAACTTCTGGAGCGCGGTC
TTTGCGGTGCTTGGCACCAAGCTGGACATCCGCAGACCGATGGTAAGACAGAGCGCATGAATCGCGTCGTCGAGGACGTGCTTCGCAGAATTTGCGCCGA
GACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACTACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACATGAACAGC
TTGTCTCATCCCCGCGTCCCGCTGACGCCGCCACTTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGATTTTGCTGATCGGCTAGCCGATGTCAGCC
CGGCTACTGTTCGTAAACAGGTTGACGCTTGCTTGTCGACGCGTTTGAGTGTCTTACGACATGTGCGTGCCACAATGGCTGAGAGCCAAGACAAGCAAAA
GGAACATGCAGATACCAGGAGCAGAGGCAATGTTGAAAGTTATGAGGTTGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCA
GCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGGCCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACTCTCAATCTTCCGAAGAAGGTGC
GGACGCACCCCGTCTTCTACGTGGGCTTGCTGAAGCTGTACCAGGACCCGATGCAGGTGCGGATGGAGGCACCGAGGGTGACGAGGTCACAGGCGCGTAG
GCCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGAGGACGCGCCCATCCACGTGGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGG
GCACAGCGAGAGCCACAGGCGCAGGAGGCGCAGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTATAG
TTCCCCGATCTTCCGGCCACGCTGCTCATCGCGATCGCGATAGTATCGCACCCAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACACCTCGATCCATCGCG
TCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGCCCAGACGCGCATCAACGTCATGGATATGATCCCGAAGGCGACCCGCCTGCTGCCGCGCCTC
CAAGAGCTCACCTTGAGTCGCAAAGGGCCCTACAGCGGCCTCCACCGGCTCTGCTCAATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGT
GAAGCGGAGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGAC
TGCCCAGACGTCGT