Description :
From Genome Similarity Track
Location :
Scaffold_7:21370- 26077
Transcript NameFunction/comments
Phyta_totarag498hypothetical protein

Sequence
4707 bases(100 bases per row)
TCAGATGCGTAGTTGATCTGCGGGGTTGATGCCTGTCCATCCTGTCATTTCCGTGTCAGCGAGACGGAAGTCGCCGTCCATTTCGACACAATTGCGTACG
GCGTACAGTACTCGCTCCCGACAGATTTCATCGTTTGAATAGCGTGGAAGTTGCAACGCGAAGAAACATGTGTGCGACTTCGGCATTTGCGAGTCCATCC
AGCCTCCGGTAGTAGCTGTCGCACCGGATGAACTACTGCCGTCTCCGGATGCAAGAGCTTGGATCTTGAACTTCTGGTGGAACTGCGCGGAGCCCAAAGG
CAGACGCGAACGTGCCCATACAAACCGCAGGAACGCACGCTTGTCCTCCGATTCCAGACTTTCCAGCACGCGCCAGAACCGCTGAATGAACTCATCATTA
GGCGACAGATCTTCGTCGTACTCGGTATTGGCCTGCAAGAGCTTCACGTCGACTTCTGCAACGCCACACATGCGTTTCTCCAGCTCGGTCCAAGTCAATA
GTGACAAGGCTGAGACCGGCATGATCGAGTGCAGTCCTTGTTTGACGATATTCATCACCTCCTGTGTTTCTTGAACGCGTGCTCGAAGCATTGCGTCTAA
GTATTTCCCCAAGTTGGTTAGATTCACAGCAGTGTTGGTACCGTCGTCGCAAAGTTCGACTGTTCTTCCATCTGATAGCACTGTCGTGAAGACCAAATCC
ATGGCTTctagctgctgctccaactcCCGTCGCTTTGCTGATACTTCTGGAGCTTGAAGATGCTTGAAATCGTCCAAAATACCTTTTAGCGTCTTCCACA
GCGAGTAAGCGACGAAATCGATCTCTTTCAGGGTTTCTAGAGAGTTCTCCGGGTTCGAGTCGTCCTCGGCTACGAGCTGCTTCCACACCGACATTGCCAA
ATCGAGACGAACGCAAACACGCGTCCGTAGACAGATGCCAATCATCTGCCCtaggaagaagaacatctCGCTGTAGAGCTGACGCTTTTCTTCAGCGCTT
TCTCCTGGCAACGTACGCACCTTCGTCGGTGGTTGACGGTTGATAAGCGCACCATTTAGCACAAACTTTTCACGGTTTGCTCCGACACCGTTCCGCCAAT
TCGGACTTGGCATGAGGAAGGGCAAAACACAGGCGGACACAGAGACACCGGGATCCAATTTCAGCGACGTGCTACTGGGTCCCCCGTTTGCAGAGCTATC
CGACGTTTTGCTCTCGTTGTTTGCCGCTTCTGGCACGTGGAGCATCTGTAATTCAGCGAAGAACTGCGAAAAGAATTCTCGGTACGGGCCCCCGTAGTCG
TCCACACCTTCCCCCTCGAACTTCACCTTAAAGCTTCGCAATTGACCGTCATCCATCGGGTGCGAGTAGACCATGCGCAGTGTTTTGAGCGGCAAGAAGT
GAAGCTCTTCAAACGCCTGGCCGAAGAGCGACAGAAAGAGACTGCTGACAGTCCCTTCGTGACACTTAGCTGCCGCAGCCTTCAACCGGTTCACCTGTAG
TTGTGGCAAGTCTTCGGGGTAATCATACTCGTCATCAGATCTCTTGGGTGAGTTAGCTGTCCTCTCCATGAGAGACGTCCAGAGTGTATTTTTCACGCAG
ACGAAGAGGCTACCGCGACATTGGGATACCAAGCGACACGGCAGCGAGTTCGAACCTGGCAAGAAGTAGTGCCATGTAAGGTCGAAAAAAGGCAAAGCAC
GACTCACGTACATGTTGCAGAAGCGCAGAAGCGCAAATCGAGCCACTACCGTCTTTTCGAGCTTCTCTCGTGGCACCGCAAGGATGCTACCTACACAGGT
AAGTTCCAAAACCGCAGTCTTCTCCTTGATAAGAGTGAGAAGCTGGTTCGGCGTCAAATTCCACGGACTAATTCGTGACACCTCGCAGAAGTCGTTGATA
ACGCTTAACAGCTCGCGATCAACTGCAATGCTCCACATTGAGTGCTCCCCGTACTTAGTGAGTTCTTCTGGGGACAGAGTAAACGAAGGTGACTGAATTT
TAGAGACCAAAGCGCAGTCACTCTCTCCGATTGTTTTACTCGACTCTGCGTCTCCACTTGAGCCCAAGTCACTTAAACTCCCTGAGGTTGGAAGCATAGG
AGCTGTGTCAACAGAAGGAATGGGCGACGTACTTGTCGTTGAGCTTGCTATCGTCACCGAACGTAGCTTTGACGGATGGAAGAACCACGCCCCAGACTCG
TTATCTACTTCTACCCATAACCTTCCAACAGCAGTACCCACGACAACTCCATTGCCTCGAGGCGTCCGAACACGGTCATCGGAGTTAAAGCCAAGCTTTC
CGCAGGTCTCTCGCGTAACATCCACCCACAGCGCTTTACCCGATCGCGTAGTAACAAATTTCGTTGACTCTGCGAGCCATTCTGTGGTCATTTTCATCAC
TGCAACAGACGTCGCAGCACGCATCGGCCTGTTTGCTACCCAGTTCGACATGACTTCGCACGCGACCAAGCAGTCCTCAACGCTCGCGCTGCCGTCTTCA
CCTGTCGGACAGATCTCGGGTTCATTGGTGCCGCTGCGACTAACACAACTATCCTTTGCAAAGGAGAGTTTTTGATGTCGAGAGTAGAACGCGACAGCGG
GGCAGACTTCGCCGACGATATTATCAAACGCCACACCTAGATCAACCCCGTTCTTACTGAACGACAGCTCTCCTTTCTCGCAATCTAAGCGCAACCCGAT
GCAGTCACCTTCTGTGAAGGTCTCGCCATACGCTCGTACTCGATTGCGTTGGTAGTAAAGTGCTTTGTCGCCGATGAATCCCCAGGACTGATCATCAGCA
CCAAGGAACGAATCCAAGTTCGCTTGTCGAGTTGCAACACCAACAAAAAGATAAGGGGAGCTGGATTTCTCAATACGAACGACCCAGGAGTGAATTCCTG
TGGAGAAGCCCACGATTGCACACGCAGCTTTCCATACTTCATTTCCACTATACGCCACACTGAGACCGTCTTCTGCAAACGCtagcaagctgctgcggct
tcgTTTGCGATCGAAATGCAACGAGAAACCTTCAGTTATTGGATGTATTGATGCAGTAGGAGACTCCAACAACAGGCCACCTCCACTACTGCTGCAGCCT
TGCGTAGTTGAAGCACTTGTCAGTTGTTGAGCCACATTCAAGTCCGTAAAACCTGTCAGACTCTGCAAAACGTGAAGGAGCTCAACGTAGCTTTGAAGGT
ACTGCGAGAACAGCAGACGGCCTTGTATCAACTCACGACTGTGCCGCATGATAGCTGCAGTTAGGAACTCTCCGACAACAAGTTGTGACGCGTTCACCAC
GTCTTTGTCTTGACTTCTAACGGCTATCAACAGTCTGCTGATAGTCCGAAGCACTACAAATTTGAGTGGCAAATTCGTCGTGCTTAGACAACATCGTAGT
CGACGCAGAACCGTCTTAGTAAAACCAGCAGAAAGCGAGAACGAGGACCTTGTGGGATCAACCAATAATGAGTCAAACATCCAGATAACCACTTCGATCC
CAGGTTCTAGCACCACGACTTTGTCTGGTCTTTGGAGATCACGCTGAGTCCACAGAACAGCTTCGTAAGCTTTACTCGACGCTGCGACTTCTACATCATT
AAGACACAATTcaaatactgctgctgtaAACATAGCCCCGTCGCGGTCGACAAAGCAACTAAACGCCCTTGAAAACACTTCGTCAATCAAAACCTCACGG
AGTTGTGGGGTCCTTATACCTGCCACGTTAGTTCTCGAAATGATTGTAAATTGGTCGCCACGTAGTAAaaccagcttcagcagcttaAACCATTGTGCGT
AGGAGATAATTAAACGTGGTGTCGACACGATAGTAAACTGTGAAGAAGTCGTTTGATGCAGTAAAGTGGCCATACACTGACGGGCATACAAGACGGATAA
AGTGTGCTCGAACcttcgaagctgctcgagaaggtCTCTGAGATCAAGCTGGTTGATTTCCGTCATGAAATCCTCCTCAAGGGCTGAACGTGGTGCGTCT
GATGCGTTGTCAGCAATGGGCTGAGGAGTAGATGGTGCTGTCTTCACTTTCATCTCTATCGCATCAGTCCTCCATGAGCACAAGAACCGCGACTTGGTGT
TGGAGAGGAAGCCTCCGTCTTCAAATGGGAAGTACATTTCACCAAAAAGCTTCCGCCCCATCTCTTTGTCATTCAGCGGCGGTGCAGCGAAGCTGTCGCC
TTCGCAATCGGTGAAAGAAGGTTTTGCTATTGGCTTATCAGTGTGCGAGTCGCTCGTAGCCGTAGCTTCATCGTTATCTCTCCATGCTGCCGACTGAACC
CAGCTATGGGACGAATTCAAAGACGGAGGCTGGGTACTATCACAAGTCGCATCGTTCGAAACCTCgacatcgtcttcttcctcgtcgaagCGAGGCGAAT
CTCTCCCTTTGTCACGCTCTTTATCCAGAGTAGATTGTAGTTTACTCAGATACTCAAGGTTGTCGACTATCCAGGCCGACGCACCCACGATATCGTTTTC
AGTTTGCTTCAACGCCAGCACACACCAGTCTTCTGGGAACCCCATCAGCATCAATTCCTCCACAAACTCTGCCCGggtttcttctgcttcgtcttcatca
tcatccacaTCCTCAAGactctcttcttcatcttcatcgtcgtcctccccTTCatcaacgtcgtcgtcgtcgtcgtcttcatcttggacAGCAATTCGGG
GTTCTTG