Description :
From Genome Similarity Track
Location :
Scaffold_595:2137- 4146
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_595-abinit-gene-0.13Protein kinase

Sequence
2009 bases(100 bases per row)
TCGCTTTGGCAACGGCTTCACATGACGTGGGATTCCTACTTTCTCTTTTTCACGCTCGCGCTCGCGATCTGCAGTATCCCTCTGGCGACGAGCCTGGCCG
TCGCGCTCAAAACCGCCAACAGCGTCGCGTTGCGTGCGCGGTGCGAATTCCGCGAAGGCAATGACAAACTCCGCCAGCGCGAGATCAGCACGGCCATGCT
CGCCAGCATCATCATTCCTATGGTGAACCACATTGTGCTGCTCTTCGTCTCTCTCTGGATCGCAATCCGGTGCAGCTACAGCCGCAAGCGCGTGCTCAGG
AGCTCACCATCGAGCATGAACACAACACTGAGTACGTGCGCCCCCATGCATTCTCTTTTTAGGTGCTTGGGCTGACTAACGGTTGCTTTCTCATTCATAT
AGCCTCGGCCTTCATGCTGCCATGCTTTGAGTTCATGTGGTACACCATCAGCTTCCTCAACGCGGCCGGCGTGGTACTGTTCGCGGTCAGCTTTGGTCTC
ACCGCATCCAAGCGGATACCTACTGCGGATGGAGGCTTTACGCGCCATCGCCTCGACCTCGACCTGAATGCCCCGTACCCGTGTGATCTCGTCGTCATCC
CGTTCACGTGGATGCTGCAGCTGCTGCCGTTTCTTATGGCGCAGCACTCGGTCTCCCACGAGGCCGTGCGGCGTGCCATCGTGTACTCGGGTGTGATTTG
CCTCTGCATCATTGTGCTCCAGATCACGCTGTTCAAGGAAGGCCACGTCGCCATGGGCGCCATCTCGGTCGGCGTCCACGTCATGCTGCTCTCGTTCTAT
TGCTGGGCCAAGTTTCTCTCGCACGCAAGGTCAAGCTTCGACTTTTTCTTTGTCGTCGCCATCTTGGACTCGCTCACGGCCATCACGGTCGAGGTGGTTG
CCATGGGTAGTCCCAACTATTCCTCTAGCTCGCCGCACATGGTCGGCCGCTGCTTCGTCATGAGTCTCGACGCGATCCTCACCGTCGCGATGCTGCTCTC
GCTGCGCGCTGACACGCAATACTGGCTCGGCATTGACGACTCTAACACGAGCTCGCGCCATCCGTTCAAGCGGTATATGCGCCACTTGTCGGAGCGCGGC
ATGATTACGAACTTCTCGACGCGCACGTCCGTGTACGATGTACACCGCATGATCGAAGAGCATCGCAACTGCGTGGTCGACTTTTCAGCGCTCAAGCTCG
AGTGCGTCATCGCGCAGGGCGCGACGTCGATCGTCATGCGTGGGCTCATGCGGTCGAAACCGATCGCGCTCAAGATCTACACGTCGGTCCAAGTCACGGA
CGAAGAAGTGCGGCGGTTTTCCCGTGAGACGGCTTTGAATGTGCAGCTCTCGCACCCCAACATTGTCAAGTTCCACGGGCTGTGCGTCGTGCCGCCGTCT
ATTTCCCTCGTGTTCGAGTTTTGCGAGTATGGCGGTCTCGATGGTGTCCTGGGCAATGGCAGCATGCACTCGCTCTCGACGAAGTTGCGCGCGTGGCTCG
ACTCGTGCCGCGCGGTTGCGTACTTGCACAGCTTTTCGCCGCCGCTCTTGCACCGTGATATCAAGACGGACAATTTCCTGGTCGGCCAAGACTTCACGCT
CAAGCTCGCGGACTTTGGCGAGGCCAACTTGCTCAAACCGCGTACGGACGGGACCATGACGATCGCCGGCACGGTGGACTACATGGCGCCGGAGATGATC
CTCGGCGGCAAGACAGCGCGGTACGGCACGGGGGTTGACGTGTACAGTCTGATGATCACATTGTGGCAGATCATGGTCCCGGACCGCAGTCCATGGGAGG
GCCGGTCCCACTTGGAGGTGTATACGTGCGTCGCGAATGGCGAGCGACCACCGCTCCTGCCCAGCATTCCCTCAGGCTGTGCGGAGATCTTGGAAGCTGG
CTGGGTCGCGAACCCGTCCGAGCGCGTGGCCGTGGAAGACATTATTGCCAAGGTGCATCAACTGTGGCTGCTGTCGACCCATCAGAAGACCCTCAAGCGG
ACCAAGTGA