Description :
From Genome Similarity Track
Location :
Scaffold_36:21367- 23884
Transcript NameFunction/comments
Phyta_totarag1749conserved hypothetical protein

Sequence
2517 bases(100 bases per row)
TCAGAAGCCGAGCGTCGCGCGCTTGTTCCGGTACGCGAGCTCTGCGTCCGGCGACGTTGCGTTCGCTAGATGATCCGCAGTGCTGCcgacggaggagatg
ctgcCTGGTGCCTGCGCACCGTCGGTGGATTGCTGCATGAAATACGCGTGggcgagctccagcaccttcacccACTTAAGCATCTCTTCGCGGTTCTTCG
CAACCATCCGCGTCTGCTGTGTGGGCGAGCAGACCATGAACTCGTTCGGCTTGCCCACTTCTTTGCCGTGCAGGATCTCCAGAGACTTGTGCATCAGTGG
GATCGCACCACGCGGCTCGCGATCACCCTCTCGCTTGTAGTATCGAAGATATCCGTCCGGCTCAATGCTGCACCACCGCTCGCGAACGCCACGCAGCGAC
ATGTTGCCGAATGTGCTCTTTTCATTGGAGTGAGTTGGGTGCTTGCGTAGGATGCCACTCATTGTTGGCAATGAGCCATCTCGAGGGACCTGGTTCGAGT
TCGAGTCGTAAGACTGCGTCAGTGAGCCGAcagacgcgctgctgctgcttcggtgGCTGAGGTTAGGATCGTATCGTTCTGAACCTCTTTGCACACTAGC
CGAAGGTCTGTTGCCACCATGCGAAGCCCGACTGCCAATCATGGACGCCCTGCTACCACTGATTGAGGCTCGAATACTGCCACCAAGCGACGCACGAGAG
CCGCCAGTGGACCTCCGGGGAACGTCCTGTATCGTCGGCGGGCCGACAACAGAAGGTCTCAGGTACGGTTCTTTAGCCTTTACAGACACGTTAAGAGTTC
CTTTTGTCAGCACCTGGAACTGATCTTGCACCACCTTCATCTcgtccttcagctgcaatCGCCGCTTGCCCAGCTCGTTCTTTCGTGCCTCGTCCTTTTC
ACCTGCTGCCTTCGCGAGCTCAACAACGGTTTCATGCAACTGAGTTTGTAGCTTAGTCAGCTTGTTCTGTAGCCGCGACGACTCTGACACGCGTTCGTGT
GGAGCTTCATCAATATCAACAGTGTCAATCGACGAATCTGCGTGCTGCAAGGCAACCTTCCTGCCCTgatcgacgtcgaagaaAACCTGCAACTCATTTT
CCATTCGCCGCATCTCGTCCAGTGCCGACTTCAAATCATCCTTCAGGTCAGCTCGTCGGAGCGACAGATTGTCGGCCTGTTGCTGATCTCCACCGCTTGT
TGCATTCGCTATTCCGGACACAGTTTCTCGCAggttcttctgcagcaatgcaatCTTGTTCTCCAAAAAGATCAGTTGAGGTGGACGTTCGCCACTAATA
AAGGCATCCTCGCGCTtgaccgctgctgctgccacatCCATTTGATTCTGAAACTGGTTAATCTCCGATTCCACGAATTTGGTtcgctcctcctccattt
tgatctcttcttcgagatgATCATGTTGTGCTTTAATCTTCTGAAGAAGCCGTTCACGTGCGTCCTCAGCGCGAGTATCAATAGAGCCTCTGTGCACCAT
AGAGCCCAAAAATGCCGGTGAGAAGAACTTGATGTCGTACTGGCCATTCGGATCCACGTCAAGATCTCCGTATTCGTCCAACTCTTTCTGCAGGATATCC
AGCGACTCCTCGATTTTGACGCGTGCTGCCTGCAACTCGTCGTTTTCGGCAATAATTTCCGTGACGTCCTTCTCAAGCTCAGCTGTTCGCTGGACTAGTT
CTGCCGTCCTTAACACCTCTGGTGATTCAATTTCACCAGCCGCTTGCTTGTCCAACTTCTCGATCATTTCCTTGAGTGAAGCTTCCTCTTGGATCAAGTT
TTCCCGCTCCTTCTCTAGGGATTCTTGACGCTGCTCCTCCCCCTCAACTTGCGTCTCCATGACCTCGCACTTCTTTTCCATCTCAAGGCGTCTCAGGTGC
ATGTGATGCTTCGTCGCCGCCCACACTTGCTTGTGAAGTTCGTTTGACACCATGATCTGGAAGTACTCCACACGGAGCAAGTTCTGCATCACTCGTACTG
CACGAGCCTCCTTGccttcttctgtttcttcgtgTGGAATTTCTTCCTCGACTCGGCCCACAATGCCTTTCGTGATATCGGCGAACTTGATGCGGACGGG
ACGCACCATTCGAGCGAGCAGTTCCAGTACCTCTGAGTATGTATACCCGGTGAGTGAAATCCCattcatcatcgtcactcGCATGTTCACTGCAAGACGC
TTTTCAGGCTTCACACTCCAGTTATAAATCTCTGCAGGACTTGCCATTCCATTTGGCAGCTTGTAAATCTCTGCAATGTGGACCTGGAGGTCAGTAAACA
CCGTGCCTGGAATTCCAGCAATTTGCTTCAGGTTTAGTCCAAGTCGACCTGGTCCAAATGTCACCTCGATCTCATGCACCCACTTGTAAATGACACCAGT
TTTCATGGGAGGACGCAACCACTGCGTGTGTCCGTAAGGTGATACATAGTACGTCTTGCCGTCATTGGTTTTGCTCTGGCGTGTGGACCAGCCCTTAGGC
ATGGCCAGGATCTCGCC