Description :
From Genome Similarity Track
Location :
Scaffold_106:2136- 11474
Transcript NameFunction/comments
Phyke_g6720hypothetical protein
Phyke_g6721hypothetical protein PHYSODRAFT_501851
Phyke_g6722hypothetical protein

Sequence
9338 bases(100 bases per row)
CTGCACCTCCTTCTACAACAGTATCCAATCCATGCTCCAGTTTCGCGACAGTATTAGCAAGACCACCGCACTTTCGTAATACCGACCAAAGCCGTTCATC
GTTAAAGGCATCGGTGGGGTCCAGATTGGAACGAACCGTGCCGGAAAATAACACGACATCTTGTGGGATGTAAGTGAGATTTGATCGCAGATCCTGGAGA
CTGATCGAGTCCAAGGGCAAGCCGTCAATCAAAATGCTGCCACTGCGTTCCCAAGGAATGACTCGGAACAACGCGTTGAGCAGAGTCGATTTCCCAGCAC
CAGTACGACCACAAATTCCCAGCTTTTGGCCGGCCGGGATATCGCATGTGACGTATCTCAGGGCTGGAGCCGCCACTCGCGGACCGACCCACTCCCACTC
GGCATCTCCAAAGTGATCATGCTGCTCGAAGCCTCGAGTAGATGTGGCATACGTAACCGTCAGCGCCTTAATTGCAATAACTCCATGCGTAGGCCATGAC
GGTGGCACTTCTCTCACTTGCACAAAGTCTCCTGCTCCAACAACAGTTTCCTCGGGCTCCAAATCTGCGTATTCCTTGACACGCTCAACAGCAATCATTT
GGCGCTCCGTGTCCACAAAACTATTAAGGATTGAGTTGAGCTTGCCGACAATAGGAAGCGCATACGTGAGTGTGAGTCCTAGGATGCCAGGATTCACTGT
CCCCGTAAGGTTGAAGTCTGCCACAGCGAAGACTGCGACGAAAGATGTAACGCATACACCTAACATGTCGAGCCGCAAACCAaaccaagcaccagcagtt
gaACTCAGGAATGACACTCGCTGGCTACGGTTTAGTCGCACATAATAACCACGGGCGTACTGGCGCTGCTTATACGCTGCTCGGATCACAATTAGACCCT
CTAAAGTGTCGGTGAACATGGCCAACAGAGGTgactgtgctgctgcatcaagtcGCCTGAGGTGACGTGAGCTCGGCCGATAGTCACGTTGCAGGTGGAA
GTACAACACACTTAACGgcaccaacaacaccaagacCAGGCGATTTCCATAGAAGAGGATAATGAGCGCTCCAATCACATCTGCGGCATCCTTCAAGAAC
AGATTGAGAATGAACGGTAGCGACTCATCCACGGCGTAGATATCCCCGCTCATCCTATTGAGCACACGACCAGTAGGTGTACGCTCGAAGAATTGCAGTG
GTGCGGCGAAGACGCTCCTAATCAGTGTAGCATAAGTGGCGCGAGCTGCCCGCAAACCCCCATAGGCAAAGAGAAATGAGCGGATGAAAACGGCAGCAAT
GTTCGCGCCAGCGATGTACAACAGCACGGTCGCAAATTCGTGTGGAGTGGTTGCATGCATGCCGTTTGTGTACACAGCAACCCACCAGTCCAGTGAGTTT
CGCGAGATCTGCATGGCAGCTACAGACAGCAAAACCGCAACTGACAGCACCCAGCCTACCGATAATGAGTAGGCCTTCCAAACATGCCAACCCACCACTC
CAGACTCTCGGtgctcttcgtcctcctccttggagtcttcttcgtcctctaTTTGCGTTGCCTGTTTCTCCTGGGACTCGGTAGCTAGTGCCAATGGACC
TTCCTCCTCGACACCTCCTGCTAGCTGTGATTCAGAGTCACCATCTACCTTGTCcttggcttcttcctcggTTGACAAACTCTCCAACAAACTCATGAAG
CGGCTAGGTGGTTCTTGCACTTTTAGAGTATTGTAAGTTCCCTGCTCAATGATATTCCCGTCACCTACGATGAGAATCTGCGCAGTCATGGGGAATAAAG
GAAGTAGTTGAAGCGAGTGCGTCACgatcaccacagcagcatcatcagGAAAAATGTTGGAGCCCGATGCAAAACAGTTCGTGACCACTTTGCGTGATGT
ATTCATGTCCAACCCACTGAGCGGATCATCAAGCAGGTAGATACCTGCTCGTTGGTAAAGAGCGCGAGCAAGGTTGATTCTGGAGCGCTGACCTCCACTA
AAATTGCTGCCGCTCTCGGCTACAGAATATGGCGGCTGTATGTTTTTGAGGTCCACGTCCAATTCACATGCACGCAGAATCTGATTGTACCGAACACGAT
CAATGCGGTCCCCGCTACCAAagtctccatcttcttcactacATAGTGTGATATTTTCTTGGACACTCCCGCGAAAGAGCCACGGGGTTTGCGGGGCATA
AGAACAGCTTGATGAATGCTGCCGCCTGTGGAGTACCCCAACAGTTAAGGTCCGTCTGGGCATTTCACCAAGTACCGCCAATAAGAGAGACGATTTGCCC
GCACCCACAGGGCCACAGACTACGTATGTCGATCCTGCACGCAGGTTCAAGTGGTTGATTCGTAACGAGAATGGATGAGTGGTGTGTGATCCTGGAATTG
AAGCCGCTGTGTCTTGCATCAGGAGAGCTGTCTCGATGGTGGAGTCTTCAGAatcctcatcgtcaccaaGATCCAAGTTCCACTCAAACTCGCAGTTGTT
TATGCTTACAACAATTTCGCCTCGCTCCTGTTCCTCTGCAGAGGTGGAAGGGGGCACATAACTTTTGTCACTAGCTAAGATATATCCCTCTTCGTCTTCC
CTATCGAAGAGGAAGTCACGAATTCGTAACGCTGACACCCGGGCTTCCAGAAACCCATTGATAATCCACGGGAAGTAATTCATCGGGAAGATCAATCGGT
CAAGTAGTGCAATAGCTGTGAAagcgtctgcagctgaaATATCTCGCCCGGAGAAAACCGCGGTAGCGAAAACTGAAGTCTGGACAATCACTGGGGTTGA
CGCCCAAAAGAATACGCAGAAGGCATCTAAATACTTGCGCACCTGCAGTCGCCCCATTTCAAGCGAGCGGCGTGCACTCATGGCCTCGAGCCGCGGTACG
ACCCAGCCTAGCAGCTTTAGCGTACGAATCGCTTGGAGTGTTTCGGCTGCGAGGCCTATTCGTTCATCGCGGAAATTCATCATATCAGCAGTCACTCGCT
GAATCTTACGTCCTAGTACAGTCTGCAACGGAAGCATGACACCTAGCACCGCTATACCTGCTACAAAGGCCACTGAAATTGCCTTGCTCAGCAACACAAG
GGCTACGACGATCTCAGCTGGGATTAGTACCATGTCGAACAGTGTGCTAGGCATGCCAATAATCCGTCCAACATCGACGGAGATCAGGTTCGTGATACGC
CCAAGTCCGCCAGCTCTTCGTTTTCCGTGCCCAGACAAGTGCAACGTTCGTGCATAAATCGCGGACACCAAACCAGCACGAACGCGCAAATCAAACCGTT
TCCAGGCCAGATTGTATTGTGTGCCAGACACTGCTGAAAGAACGGACCGCCCTATCATTGCCGCCGCTAGATAATATCCCGTCGACAGTGACGGGTTTGA
CGATCCAGCCCAGTCCAAGAAaagcttgagcagcagtgggCTCGCTAACCCGATCACTTTGTTGGCAGTTGACCAAGCGCCAAACACAAGCACATCAGGT
CCGTACAATCGCCGGGTCACACGCAAAAACGACCGCTCTGACGGTCTGTGTTTACGGAATTCGTGTTGCAACTCGTTCTCAAACAAGTCTGCGGCGACGG
ATGTGCTATCCTGTAGTGGAAGGTTGGGAACATCACGCATTTCTTGCCGGCGTTTCTTCCCGAGCGCAATGAACGGTGAAACCCAATGGTACGACAGCTG
CGAAAGCCATCCAATTCGGTCCAGCGGGCTCGCCATCACTTCATGCCTCCCAATCGTTTTCTTGCCGCGAGCCTTACGATTCTCCACGAACCCACCATCA
CTATGACCTTCCTGCGTTCTAGGTTGGCACACTAAGACTCGAACCACCGTGACAGCCGCAATAACAGTCGATAACATTAGCTTCCAGTGCATCAACGCTT
TGATAGTCCAATCCATTGACACGACCTCTCCAGTCAACGAACTCCCCAACGCCATCTCCTCAATAGCAGAGACTAGCACAACTAATGTGATAACCACATA
GCTTCGTCGACATTGTACAAATTCGAACCGTAGCACTGCTGCGTAGAAGAACCAGGAGACTACTGCAAGGGCTGAGCCACACACTAACGGCGCTGAGGAA
TGAAGAGGCGTTGCAATGATCATCACAGCCGCTGAAACAGCCATTGCAGCCCCCGATAGCAGcaaatgcacagcaaaaaAACAGAACTCGAGCTcattcc
agcagcacgaacgccTCTTATATCCACTGGCGAGTTGCAGGACACGTTTCATACAGAGTAGTGCTAATAGAACCAGCGACGCTAAACACAGAGAGATAAG
TGAGACTATCATGCCATTGACTCAGACTGCACAGTAAAACACACCTTGAAAGACTAACAACTGCGTGCATTGCGAGGACCCCAGCGGTGATCCGTTGAGC
TCCACACAATACGCCGAGAGCAGTCGCATGACCGATGGATGAATCCTACGGCGAGAAATCAGCGACGAGACGGGTCTATGCAAATCTTTAGCTATGAGCG
GGCGGTTCCCATTCACCAAGTGCTCAAGCCCCTGAGCAAAGACTGCGGTGGTTAAAATGTTTATACATGTTATCTCGATAAATTACTACACAAAAAATAT
CGCTATGATGCCAGCCAAAGCTGACGGCTTGGTCCTAAATTTGCTGCGGTAACACTGTCAGCCGCTTTGGAGACAGTCACCTCCACACGCAGCTTCTCAG
TTTTAGCAGCCTGTGCCTCCAGCTACTCGAAGACAAGCTGTGCTTTCGAAGAGAGACAGTATATTCGCAGTTGTTGTGTAGATCAGCACGCTGAGCAGGG
TGACGACCACCAACCATCCTGCTGACGTACTGTAGCCGCCATAGTAgcgcagttgctgcacctcAAGCTTTTGGTGTGGAAGCAGTCCGATGAAAGCAAG
ACTCAACAGCTGCAGAGCCCATGCAATCAGATATGTGTAGGTGACCTGCAGCCGCGTGGGGTCGGAGTCAGCATTGATATTCTTGTCCGAGATCGAGAAG
TACGAGTCGATGGCCTTGTACGCCGTCACGCCGAGTGGGATGGCTAAGTTACGGCAGGTGATCACGAGACCATAGGTAGTCCCCTCAAGACCTCTCGGTG
CCAATTCCACTATCGGGAACAGCAAAATGAGAAAACGCAGAGCCACTGCCGGAGCCGCGAGAATTTGCATGTACAGCCAAAAGTATTGATTTCGCAGCAC
TTCGAACACCGTACATGCCACCGTGACCACATCGACTCCAACCGTCCAAACGGTGGCGACACAGAAGAGATGTCCCCACGACTGACGAAGTAGAAACCGA
TGGGTCACGAACAAACCTGCAATATAAGCCAGTCCCCACACCACAGTCGCGATCGTCTTAGGCCATTTCTCTACATCCACCCAGTTAGCTTCGATACCCG
AGCTCGCGTTCGAGTCAATGGTCAGGCAAAAACTCGCCATGAGCTCGAACATCAATAGCTGCCACATCGCTCGACTCTGTACGAGTCGCCAAATGAGATG
ACAGCGTTCACTAAAGTCTAGCGGCGGATTTACGTTCGGCTGATGGCGCTGCGGTGGCACAGGACACGACACAACGTCAGAGAAAGAGAGGATCGGCACC
ATTCGGGACATGGTCTCTTCGTGGAGAAACCAGATCGATCCTGCAAGCGGCACCAGCGCACACATCGCCAATACCAGCATAACTTGATTAACATCTAGCG
ACCAGGAGAAGCTTCCTCCATATGAAGGCCCATTCAATGCCCCCGTCACAAAGAAATTCATGGCAACAAGCCCAAACATTCTGGCAGCGTAAATGCATAC
CTGCGTGTGTCCACGCGTCGACAATGACTCACGTTGCGCGATCTCTACCACCAGGGCGTCTGCAGCCACATTGGCCAGAAAATATCCTACGGTAGCGAGC
GTCATGAACAACATATACCTCCACGCCTCGTCCGTGCCTCCGGTCTCGTTCACCCCCGTGGTTCCAAGGAACAGCAAACTCCCAAAGCACAGTACCCACC
CGGTCAGAAGATAGGGTTTCCGTCGATACCCACAGATCTGAACACTGTCCGTCAGGAACCCTCCGAACACCTTAAAGGTCCACGCTGTGTTGATCACCGT
CCCAGCTGCACGCACCTGGTACGGCTTCAATTGGAGATAACCGGATAAAAAGGGCACCAGAGCACTGTTGATCCCCCCGTACATGGCGCCAATTCCCACG
TaattcagcagcaagccaAACGTCCGACGACTGAGCAGCGGCACTTGTCCACCAGGTCGCAAGGCGCCGTCGTGCTCCAGTCCGTAGAAACCGTACTCTC
GACGCTCGCCCATGACGTACGGGTCGGGTGGCACTGCTTGGAGCATCACTAATGGGTCTCCACGCAGCTCTGGAGGCAACGAGTCCAGACTGAATGATAG
AGGGGAGTTGGGAGACATGGACATGGACGAACTCTTGAGCCAGATTCTAGATGACATAGTACTGATGACGTATGTAACCGTTAGGCGCGACTAGCACAAC
CACGTCATCCACTTCAGAATTGGCAATAATGATCAAGTTAGAGGGATGTAGGTGGACAGTGATGGATGGAAGGACGACGCAAGACTCAAATCTCGACTCG
AACGAAAATGCTTTTTTGCTGATTCCGCTGTTTGGTTGTCGAGGTGCAAATCGACTGTCGCCAGTCGCAGGTTGTGATAGACAGTGTGTGTCATTTAGTC
AGGGCAAATCATTTCAGAGgtatgtggaccacatgaCCTTAGTCACAATAAACTTGCATGGACGTCTCGACACTGCAGATGCTCGTGTAATCTAGCACAA
GCAGAGCATGTGATACAAGGTTCATGTGCTTCACTCATAAGTCATGAGTAATGAAGAATTCCAGCGCGGCAATAAGCAGCGTCGCGTTCAACGTATAGAA
GCCTATTTTATGTGGTGCACATATATCTCAGCCACTCTACCGAGGTAAAATACTGACCTCAGTCCTATGCGTCATTTTCGCTAACGTCGCTATGCCGTCT
CGACGATGTCGGCCGCTGTGGTTCGTGTGGGACCCCGCGGGCATTGTGATCGCCTGCTTCGCGTGGATTATCCTCTCCAGCCTCCTCTTCGCAGTGCTGT
CGTCCATCTCTCAGTGGGTGGGGCTGCTATCCCTCATGGGGATGACGGAAGCGCTCTGGTTCATGGGTCTCTTCTGTATGATCCTCTGGTGCCACATCAC
AGTTCTCACCACCAACCCAGGCACTGTACCATCCAAACTGAGGGGAATTCTGCCATCaagtgacgaagaagaagacgtggaggaggtggaagaggaGATG
CCGTTGCAACAGTACGAGCAGTGGGAGGACGACGGATCACTGCTCATCTACTGTGACGAGTGCGAGATCTACCGACCTTCAAGGTGCAAGAGCCCTTTAG
CTCTTTAGTGTTAAATTTTTAGTATTGGACTGATGGTATTATTGTTGACGCAGAGCTATGCACTGCCACACGTGCGAACGATGCATTGTGCTGCAAGATC
ATCACTGGTACGTGGCACTCTTGAGTGGGTGTGTACATGAGGTGCTAATACTGGTGTTTATTactttgctgttgctgtgtgaCTGTAGTCCTTGGGTGAA
TAACTGCATTGGTATTGGAAACCATAAGGCCTTtttgttgcttctgctgtaCGCAACTGCGGCGAGTTTGCAGGgggcgttgctggtgatgtTGCAGTAC
GCCATGTGCTCGCGGGGCAAGTACTCGTGCGGGATGCAAACGGATCAGTTCCCTGGAAGGCTGGGCGGCTGGATCCTCGCGGCGGCGGCTGTATTCGGCC
TATTCTGCTCGCTCATGCTGGCCATGGAGCTGTTCAATATTTACCAGGATCCAATCTTCACACAAATTGCAAGTCAGCTGGCAGCTCGACGCGGAGGAGA
CAAGTCTACTTCAACAATGGAGCGCCACTTGAGTGTAGTGTGCGGTACAGATGGTATGCGTGCGTCATGGTTCTTCCCACCCCCGGAGAGGCGCGCGCTG
CACGATGTGGAGATCGTTCAAGGGTTCCGATGCAGACCAGACGACGCCAAGCTCTGCTGAGATAAATTAGTTCTTGCGAATGAATGTGCGCAAGTAACGC
CGGCGCAGGGCATCAAAATACACATGTTCAACTAGCTATAACGAAGATTGAAAACTTCAGTTAGATGACGGTTGGGCTGGTCGGCTCCATAATCAGTTTC
CTTGAGAGCCAGCATCTCAGCCGAGGATATTCCCTAGCGGCGTGGCGATGGAAATGTCGTCAAGCAAATGGCATTACTGGTATACTCTAGTACGCACTCT
GCTTAAAGTCGTTGCGTTGAACTTCACGTGGCGATCATGGCCAAGTGAACGCTGGTAGCGCCGTCAACATTTGTCTTCACATTCGCGTTGCAGAAATCCA
GGCCACGTCGTGGCCAAATCTCGTGAATTCTACATGTCAACTACTCGAACGCACGCGCTTCAAGCCTTCAACACAGGTTAATCGCGTCCCACAATCGCGG
CTCGTAATCACTACGGGAACGATCATCGGCATGTCCTCAGGTCCTTGGCCGTCCTCCTTGGACACATTCGTCGACGTGTCCCGTATCAAGCTATCGGCAC
AAGATCAATGGGTGCAATGACCACAGACTTTGGGTGGCCCATCATCACTCGTTTTTGCTGGTTCGCAACGTGTTCCCTGTGGCTAGTGCCCACTTTATCA
CCAACCGCTGGCGGGGACATGAGTTGCGAGGCTGTCTCTGCGCTCATGGCGTCAAGCAGGCCACTGGACTTGAGTCGGGCCAGGGTCGGACGTTGGCTGT
TCCTGAACACTGTATGGCTGTGCGGTTGACAACAAGTAATTACCAGCCGCATTTGCATCATCTGGGCGTTCGCTTCATGGATGGCAAAGGTAGACAGCAG
CTGCTCGCATATCGTGTTAGCGATATACCACTATACGTCAAAAATCGGGAATGTGATGTGCGCAATCAGGTAGCTGTTTCGCGAAAACCTGCGAGATTTT
ATGTGTACCATACAAGAACACTCAAGCGGCCTGATTATAGCATGACTTCTTGGAAAAAGGAATTCAGCGTCATCATCCTTCGTTCTGTCAGTTGTCGCTC
ACTTGCATATTTTCCGTCAAGAAGACAGACCTGACCGAAGCAACAACCTGCCAAACAGACGATATTGAAACCCCTACAACACAAATGACAGCAGTGGGAA
CGCGCCCAGAAGACGACGCGCCCGTGGGCCCCGTCAAGACCATACTGGACGAGAACCAGCTATTCGACTCGACCGACACGCAGCCTacggatgaagacga
cgatgagaaCAACCAAGAGCTCGATCGCGTCAAGAACA