Description :
From Genome Similarity Track
Location :
Scaffold_66:21354- 24348
Transcript NameFunction/comments
Hyaar_Emoy2807578hypothetical protein

Sequence
2994 bases(100 bases per row)
AGCCGCCACCTCGAGCAGTACCGAGTGAGTGACTCCGTCTTGGAGACGGATTGTCCGACGAGTCGGACGATCCGAAGATGTCATGACGCTCAGCGAATCG
TCACGTCTGGCGCTTTCTTGGCGGCGTTACCCTCCGACTCGCCGGAGTATATGAGCTCGAGCTCATAATCTCCGATGTCGCGCGGTGCACACCGCATGAG
CCTACAGCAGCTACTGCTGCAGGCTGGGCGGAGGAAGCAGCAGACGAGTTTTCACCTGCTTCATTCTATGACTTTGCCTCTTCTGCGGCTGAGGAACGAA
GTATCATTGCAGCACTCCCGGCAGCTTTGGCCGCGCATCGAATGGATTCGTTAACTATGCGATGAGATAGGTGAATGGTTTGGGAATGGACCAACAAGAG
CTTCCCTGTCCTAGAATAACTTAATGGAGTCACTCAATAATCGATCAGTCACTTACGTGACTGATGGTTAGGGGGTGGGGGTGTAACGGGGTGACTCCGT
TACATGATATTTTACATAAGGTAAATATCAAGTATGAATGTTATGTTAAGACCGACATCATAGTCTCTCAATATTAGCTTAACAAGTAATGTTGTGATTC
AGAAGTAATACACTGTTCATCGGTTGATATAGAGCAATGATATCAACCAATAAAGCCGAGGCACGACAGAAGAACGCAATGAGTGGCGAGCAGATAGTTA
CAATACATGTTTGTATTTAGATATAGTTAAAAGAAGACTAAATATGATTTATCAACAGGAAATTAACTATATCAAATACAGTTCTACTTTTACCCTTGTC
TCGTTTTGAAATGTTCCTCTGCACGATAAGGGTACGTGAGATTCCGAGGCACCTGCTTACCCTGTGTTCAGAGTAAGTAGCTTGTACTGTGACAGTACAA
GCGATCGGTCCCCCGTCACATAGCGTATGTGATACAATAATACACCTGTCAGTTTTACTGATCTCTTTATGTGTGTATCACACCAGCATATCTGGCTACG
ACAACCGTTTGTGTAGCCCACTACACGCGAAGTAAGTCGAAGTGAACGGAGTTTGTCCGGCATTCTTGACACAATAAACTAAGGAAAAGTGTGCTATGCA
TACGAGAGTAGCTGAATCATGGTAGCGCATAATATAGGTGTTCGTGCTTGCGCCAGCAAATGCGCGAAAATAAGATCCCGTGACGATGCTTTGCGTGTTT
GGAAAGACTATAAACGTGATTAGTCCACAAGTGCCGATGATATGAACATATGCACTTGGCGACTAGTAGTGGTAACTCCGTTTACAGATGCTGCCGTTTA
TCTGGTTTTCTAGCTCGTTACCGATTAAATGAGCAGATAGATCGCTTAATCATACATATTAGCGACTTAGGAAGGTCGCGTTCGTTTCCATTCCAAACAC
GCAAAGTATCGTCACGGTATCGTATTTTCGCAGCAAACGCGCGAAAATACGAACACCCACATTATGCGCTACCATGATTCAGCTACTCTCGTATGCATAG
CACACTTTTCCTTAGTTTATTGTGTCAAGAATGCCGGACAAATTCCGTTCACTTCGACTTACTTTGCGCATCTTACAAAATACAAGTATAAAAGAATGTA
TGATGACCCTGAACATTAAACAAATATTTCTTTTTACTTAAAATTTTATGCTTGATGTGGCCGTATACTTTTTGACCGAGTGCCAAAGCGGCTTTTTGTA
TGTGGGGCTATGCCGCCAACGCAAAAAAATGGGACGTTAACACATGAGGGGTGTGTTAACGTCCCATTTTTTTGCGTTGGAATAAAGCTTTGCACATAAC
ATACTCAAATAACAGCGCCCAACTCGTACTTATTAGAGAATTTGAGTAAAAACATGGGTGGTCGTATATTTATGGCCCGGACTGTATTGGAAATAAAACC
GAATAAACCTGATTTTGGCAGCTACGAGGCTGTCGGGTTAAATAAAATTCAAATAAAACCGATAGTAAAAACCGCTTGGTGCCAGCCGATCTCCCCCGAA
TCCTATCCACTACTTCCACCACCAACTCACTCATTCACTTTCAAAAGCGATTGTACGAATATGACCACACAGAGGTTTCGTGGCTACAACGCCACTGCCG
AGCACGAGCTCACTTCGCTTGAGAAAGTGCTCCTTTGTATCGCTAACGAGGCCATTGCATGTCTCAAGGTGCTCAAGAGACACCTCTCGGACTTCGACAA
TCGTCACGGGAACCTCTTTACCAACACGGCCGCCTCGTACCTGCGGAAGGATTTGCGCACGGCGAAAGACACGGCACTCAAGTTGAAGCACGTGGCGCAT
CAGATGAAGCACAACTTGCAGCTGGCAGAGGCGGCTACCGACTCGGCTCGAACCGTGATGGGGGTCATTGCCAAGGCCATGGACGTCCTCAAGACGACGG
CGCACCAGTACGACGAGGAGATTATGAGGCAGTCCAAGAAGAGCAACGCGGACGAGAAGTACCACACGAGTCGGTCTTGTGAGATCCGAGACCAACGTAG
AGATGACCGACACTGCGGTCCCTTGCACGGGAGCAATTCTACCACGAGCAATGACGTCGCTATTGGTGGTAGTACAGCTGCTCTTCTTGAGTTTACGGAC
ACTGTCGAGCAGCTGGTCAAGACAATCCTGCGCGACAACTTCAACATCAGTGCATTGAGTCATCAGATTACGATCGCCGAGAAGTCGCTGTCGTCATCGT
CTGCGGCCGTCGAGCGTGTGAAGATGGTGGTTCAAGACGTGGAGGAAAAACTCGGAGGTGGCACACCGAGTGCTGAGTCAGGTTGCTGTGCGTGAGAAGC
GTCTACTATCGCCCAACTGTTCATTAGAATATCGTCTCACTGTCCGTGTCTGCAAGTGGATAAATAGTCGACGAGAATCTCGATGCCGCTGTCCAAATAC
GATGGATACCAAAGTGGCAAAATGGTTCATTGGATAATGCTTGACAAGTCTCGGGCCACGTCAAGTGTTGCTATCAAACTGAAGACTCGGCGGA