Description :
From Genome Similarity Track
Location :
contig_35:213523- 215878
Transcript NameFunction/comments
g8340.t1hypothetical protein

Sequence
2355 bases(100 bases per row)
AGGATGTTGTTATCTGTCGCCTGCGTGACGCTGACGACCGCGTGCAGTGGGCGCTGGCACGAAAGCAGTATGCCAGAGCCCTTGACGTGGCCCTTCACGA
CCCACGTGCTCTTCGACGCGTGGTGCTCACTGACGTTATGGAGACGTACCTTGGCGATCTGCTGCGGCAGAAGAAGTTTCAGAAAACTGCAGAGGAGATC
CATCGGCTTTTTATCGGTGGCGGCGAAGATTACGCAAATTTGTGGGAAAAATACGTCTACGTGTTTGCCCAGCGTGGGCAACTGAGTGCTATTGCCTGCT
ACATGCCAACGGCCAGCCCGCGGTTGCCCAAGGTGCAATACGAGATGGTTCTGAAGCATTTTTTGGATTCAGATCCGGGTCAGCTCCTCGAGCTCATTCG
GAAATGGCCGAAGCCCCGACGACAGGACACTTTAGCAGCAAAGCAGCGATCGGAAGGCGACGCCTCCGCTGTTGCACCGGAATACACCGAAACAACGCAT
GTGTTTGAGCCCCTGTATGACGCTCAGGCATGGATTAACCAGCTAGAGACGGTTGTGCGTCGCCGACGCATTGCTGAGGCGGACGCAGAGCGATTAAGTG
TGGAGACAATGTACCTGATGGAGGCTCTCGCGGAGCTGTACACAGCCACAGAGCAGTATGACCACGCGCTGCGTATTTACTTAAGCCAAGGTGAGTTCTG
CTCCAACAAGGACTTCGCATTCAAGCTTATCACCGAGCACCAGTTGTGGTCGCTGGTTGCGAACAAGGTGGCCAACCTCATGCGCATCGATAAGGCAATT
GCTGTGCGGATGCTCGTGAATCAGACGGAACAGCTCAAGATCAGCGATATTGTTACTCAACTTGAAGGCGAGCCCGAACTGCTGCACACCTACCTGCACG
AGCTCGTCCTCCACCGATTGGGTGAATACAACTCGGAGATTTACTCGGCACTGCACGAGAAACAGGTTGCACTATATGCCGAGTTTGCACCGGATTTCCT
ACTCAAGTTCCTGCAGACGAGCAACTTTGTGCCGCTGGAGAAGGTAAATTTGGGGTGGTTGCGATGCCGTTAGGTGAGCTCTGGTACTTAACTGATTCAT
TTTTGCTGCTATTAGGCTTACAAGTACTGCAGCGAGCATTCTCCTCCGCTCTGGGACACGATGATCTACATCTTGGGTCGCATGGGGCAGCACAAGAAGG
CACTCGACCTTATCTTGACACAGCGTGGTGATATCAACCAGGCCATCCAGTTCGTGCAGGATCACGATGAAGGTCTGTGGGACTACCTCATCGATCTAAG
CCTCACGAGCAAGGACAACGTGGAGGAGCTGCTGAAGTTCGCTTCGCAGCATAAGATTGACCCGATCAAGCTCATTCGCAAGGTACGCAGCGCAGTCGTG
ATGGTATGCGGGATGGCTCAATTTACTAACGCTTTTTATCGTACACACCTGACAGATTCCTGACGACATGGAGATTGTAAATCTCAAGCAGAAACTGATC
GCGATCATCGCCAACTATCGCGTTCAAGTAGGTGGCGATTGTGTTTGTTGATGGAACAAATCAAGCTGCTCATTTGCTGATCACTGTGCCTTTGCCATAC
AGCAAAACCTGTGCGTAGGTTCTCGGAAGGTGTTTGACAACGACCGCGTGGAGCTTCTGCACCGACAAGTCACTGCACACAAGCGAGGTCGGCGCGTGGC
CGCCAAGAAAGCGTGCGCCATCTGCAACGAGTTGCTGCGCGCGCCGTCCACCGGCATGGAAACGGTCCACGCGTGTGTGTTCGAGTGCGGCCACTGCTAC
CACCTCCCGTGCCTTGAGGAGAAGATGCGCATGTGGAAAAGCGCCGAGGCCGTGGAGTCCGGCGACTTAAACCGCGCGCTCGGCTGCTTCGTGTGCGACC
ACAGCACACGCGCGTACGCACGTTCAGGCGACTTCAGCCAGCAGATCGCATCGCTGACCGCACCACCCGCGCGAGGCGTGACCGAGGACCAGCTGCAGCG
TGCGAAGGACAACCTCCTCGCAAGTGTGGCGGAGTAAGGCCAGGGTATTGAGTGCAGCAGAAGTTTGCGTTGAAAGGTGTCTGTAAATCTACACTTTTTG
GTGGTGTGTACGTTTCCCAAAGTTACTGCGTGTTCAACGTTGACGGCGATCCTCCACTTCCGTAACCGTGAATGGAACTGAAAGAACCTCGCTCAACACT
GCAATGACAGACCTGCACCTGCGTTCCACCTTCCTGCTCTGTACGACGCCATCTCCCTGACAAGAAATTCAAACCTCCTAACGGTGAAGTCCCCAAATTC
GCATGATATTTTATTTATCGGCAGCCATTGCTGACCCCCCGAAAAACAAACTCCG