Description :
From Genome Similarity Track
Location :
contig_35:213522- 215877
Transcript NameFunction/comments
g7973.t1hypothetical protein

Sequence
2355 bases(100 bases per row)
GCATACGTGTGTACTCCAAAGGATGTTGTTATCTGTCGCCTGCGTGACGCTGACGACCGCGTGCAGTGGGCGCTGGCACGAAAGCAGTATGCCAGAGCCC
TTGACGTGGCCCTTCACGACCCACGTGCTCTTCGACGCGTGGTGCTCACTGACGTTATGGAGACGTACCTTGGCGATCTGCTGCGGCAGAAGAAGTTTCA
GAAAACTGCAGAGGAGATCCATCGGCTTTTTATCGGTGGCGGCGAAGATTACGCAAATTTGTGGGAAAAATACGTCTACGTGTTTGCCCAGCGTGGGCAA
CTGAGTGCTATTGCCTGCTACATGCCAACGGCCAGCCCGCGGTTGCCCAAGGTGCAATACGAGATGGTTCTGAAGCATTTTTTGGATTCAGATCCGGGTC
AGCTCCTCGAGCTCATTCGGAAATGGCCGAAGCCCCGACGACAGGACACTTTAGCAGCAAAGCAGCGATCGGAAGGCGACGCCTCCGCTGTTGCACCGGA
ATACACCGAAACAACGCATGTGTTTGAGCCCCTGTATGACGCTCAGGCATGGATTAACCAGCTAGAGACGGTTGTGCGTCGCCGACGCATTGCTGAGGCG
GACGCAGAGCGATTAAGTGTGGAGACAATGTACCTGATGGAGGCTCTCGCGGAGCTGTACACAGCCACAGAGCAGTATGACCACGCGCTGCGTATTTACT
TAAGCCAAGGTGAGTTCTGCTCCAACAAGGACTTCGCATTCAAGCTTATCACCGAGCACCAGTTGTGGTCGCTGGTTGCGAACAAGGTGGCCAACCTCAT
GCGCATCGATAAGGCAATTGCTGTGCGGATGCTCGTGAATCAGACGGAACAGCTCAAGATCAGCGATATTGTTACTCAACTTGAAGGCGAGCCCGAACTG
CTGCACACCTACCTGCACGAGCTCGTCCTCCACCGATTGGGTGAATACAACTCGGAGATTTACTCGGCACTGCACGAGAAACAGGTTGCACTATATGCCG
AGTTTGCACCGGATTTCCTACTCAAGTTCCTGCAGACGAGCAACTTTGTGCCGCTGGAGAAGGTAAATTTGGGGTGGTTGCGATGCCGTTAGGTGAGCTC
TGGTACTTAACTGATTCATTTTTGCTGCTATTAGGCTTACAAGTACTGCAGCGAGCATTCTCCTCCGCTCTGGGACACGATGATCTACATCTTGGGTCGC
ATGGGGCAGCACAAGAAGGCACTCGACCTTATCTTGACACAGCGTGGTGATATCAACCAGGCCATCCAGTTCGTGCAGGATCACGATGAAGGTCTGTGGG
ACTACCTCATCGATCTAAGCCTCACGAGCAAGGACAACGTGGAGGAGCTGCTGAAGTTCGCTTCGCAGCATAAGATTGACCCGATCAAGCTCATTCGCAA
GGTACGCAGCGCAGTCGTGATGGTATGCGGGATGGCTCAATTTACTAACGCTTTTTATCGTACACACCTGACAGATTCCTGACGACATGGAGATTGTAAA
TCTCAAGCAGAAACTGATCGCGATCATCGCCAACTATCGCGTTCAAGTAGGTGGCGATTGTGTTTGTTGATGGAACAAATCAAGCTGCTCATTTGCTGAT
CACTGTGCCTTTGCCATACAGCAAAACCTGTGCGTAGGTTCTCGGAAGGTGTTTGACAACGACCGCGTGGAGCTTCTGCACCGACAAGTCACTGCACACA
AGCGAGGTCGGCGCGTGGCCGCCAAGAAAGCGTGCGCCATCTGCAACGAGTTGCTGCGCGCGCCGTCCACCGGCATGGAAACGGTCCACGCGTGTGTGTT
CGAGTGCGGCCACTGCTACCACCTCCCGTGCCTTGAGGAGAAGATGCGCATGTGGAAAAGCGCCGAGGCCGTGGAGTCCGGCGACTTAAACCGCGCGCTC
GGCTGCTTCGTGTGCGACCACAGCACACGCGCGTACGCACGTTCAGGCGACTTCAGCCAGCAGATCGCATCGCTGACCGCACCACCCGCGCGAGGCGTGA
CCGAGGACCAGCTGCAGCGTGCGAAGGACAACCTCCTCGCAAGTGTGGCGGAGTAAGGCCAGGGTATTGAGTGCAGCAGAAGTTTGCGTTGAAAGGTGTC
TGTAAATCTACACTTTTTGGTGGTGTGTACGTTTCCCAAAGTTACTGCGTGTTCAACGTTGACGGCGATCCTCCACTTCCGTAACCGTGAATGGAACTGA
AAGAACCTCGCTCAACACTGCAATGACAGACCTGCACCTGCGTTCCACCTTCCTGCTCTGTACGACGCCATCTCCCTGACAAGAAATTCAAACCTCCTAA
CGGTGAAGTCCCCAAATTCGCATGATATTTTATTTATCGGCAGCCATTGCTGACC