Description :
From Genome Similarity Track
Location :
Scaffold_63:213481- 218334
Transcript NameFunction/comments
Aphas_H257_15113glycosyltransferase

Sequence
4853 bases(100 bases per row)
TTTGTGGTGGTGTGGAATGAGATTGTAAATTCATTCCGCGAAGGCGACTTGGTGGACGACAAGGAAGCGGCCATCTTGCAGTACGACATTCAAAACACTG
GCGAAGTGTTTGAGCCTGTGTTTCTATCGGCTGGCAAGTTGAACGAAGCGATGGCGTACGCTGTCAAGCTGGGCAAATCGGGACGCGGCGACTCGGAGCT
GCGCATCCAGCTGGTCCAGAACGACTGCTTGGGCGCGGTCAAGTCGTTTTTCAATGCGTCCATGTACGTGCTGGAGGCTTTGCTAGCGCCCGACGACACG
GAAACCCTCGACGGGTTCCGGCTCATGGAGCAGGCGGCGCTGGACGGCCAGTTTCTCACACTATTTGACGCTGGCTCGCTCTTGCACGTTCGGGCGATGG
CGATCGACTTTCTCGAAGCCGTGCTGGACCTGCCAGACCCAGACTCGGCCTCCCCCGTGCTCAAGACCACGGTGCACCCCATGGGCGTGATCCGCAACTT
TGTGGCCAAGACGGATAACCTGTTGAACGGCCTCCGGTTGTTTTGTCGGCAGTCAGCGATGGCGGCCAAGTTTCAAAACGTCAACTTTGTATCGTCGGCC
AACTCGTACGCGTACGCGGCCAAGGGTCTCGTGAACTTGTTCCACTCGGACACGGCCATGGGCGCCGCCACGCGCGCGTACTTGCTCATGTCCCTCGACC
GGCAAGACGCCATGCCCAAGTGCGGCGAGGCGCAGCGCCGCCTCGGCTTTTTCATGCAGTCGCTGCTCATGGACATCCCCCAACTGAGCGCGATTCGAAG
CATGCGGTCGTTTTCGGTTGTAACTCCGTTTTACAGCGAAGGCGTCATCTTTTCACTGGACGAGCTCAACAACCCCCTGGAAAACCACCCAATTTTCAAC
AAGGCTTCGGAAATCGACAAGAAGATCACGATCCTCAAGTACCTGATCACGATCCACCCCGAAGAATGGGATAACTTTCTCGAACGCATCGACGTGTCCA
GTGTCGACGCGGCGATCCACGAGTACCCCATGGAGCTGCGGCTGTGGGCGTCGTACCGCGGCCAAACGCTGGCCCGAACCGTTCAAGGCATGATGCTGTA
CGAAGACGCTATCAAGATCCTCCACTGGCTCGAGATTGGGTCTTCGCCGAACCGCACACCGGAGCAAAAGCAGCAGCAGCTGGAGGACATGATTCGGCTC
AAGTTTTCGTACGTGTGCGCGTGCCAAGTGTATGGCAAACACCGCGCCGAGAACGCCCAGCAGGCCAACGACATTGATTTTTTGCTGCAAACGTACCCCA
ACTTGCGTGTGGCGTACGTGGACACGATCGCATCCTCTTCCGATGGAGCCACTCGATACGAAACGGTGCTGATCAAGGCCGAAGGCGACGACATTGCCGA
AGTGTACCGATGGGAGCTCCCCGGGGACCCGATTCTCGGCGAAGGCAAGCCGGAAAACCAGAACAATGCGCTGCCATTCACCCGCGGCGAGTTTCTCCAA
ACCATCGATATGAACCAGCAGCACTACTTTGAAGAGTGCCTCAAGATGCCCCAGCTGCTCGTGACGGCCGACATGCACGCCTCCAAGAAGCCTGTGACGA
TCATTGGCATGCGCGAACACATCTTCACGGGCAACGCATCGTCCCTGGCCAAGTTCAAAACGTGGCAAGAGCTCGTGTTTGTCACGCTCAGTCAGCGCGT
GCTCGCCAACCCGCTCTGTGTCCGCATGCATTATGGCCATCCAGATATCTTTGACAAGGTGATGGTGCTGACCCAGGGCGGCGTGTCAAAAGCATCCAAG
GGGATTAACCTGAGCGAAGATGTGTTTGCTGGGTTCAACTCGACCCTTCGCGGCGGCGTCGTGACCCACGTCGAGTTTATGCAGTGCGGCAAGGGTCGCG
ATGTCGCCATGTCGCAGATTTCCATGTTTGAAGGCAAACTGGCCAACGGCGCGGGGGAGACGGCGCTGGCCCGCGAAGCATACCGCATGGGCGCGTTCCT
CGACTTTTTCCGGCTCAATAGCATGTACTACTCGCACACTGGGTTTTACTTTGCCACGTGGCTCACGATCGTCACGTCGTACGTGTACATTTACGCCAAA
GTGTACTTGGCGCTGTCGGGGGTCCAGACCCAGATTGTGGAGCTGATGAACACGACCCAAGTGATTTCGCTCAACGCGTACCCGTTTGGGTTTGATGACC
GCGTGTACAACGACCTGGACAGCGTCATGAACACCCAGTACATCATCCAGGCTGGTCTGTTCCTCACGTTGCCGCTGATTGTCGTGTACTTTGCCGAATT
GGGGCTCATTGGCGGCGTGACCAAGCTGGCCAACATGATCTTTACGGCTGGCCCAGCGTTCTTCGTGTTTCAAGTGGGTACGACCATGCATTACTTTGAT
AACAACATCATCCACGGCAACGCCAAGTACCAAGCGACGGGGCGGGGGTTCAAGATCACGCGGGAGACGTTTGTGTTGCTGTACAAGGCGTACTCGACAT
CGCATTACCGCAAGGCGTGGGAACTCGTCGGGCTGTGCATGCTCTACTTGACGTACGGGAGCTTTAACATTTGCAACCGCGAGCCAAAGGACGGTAACAC
GTTTGCAGCCGACTTTTGCGAGACGGCGCAGGGCTACGGCACGCAGACGTTTGCGATCTGGTCGATTGCGATTCTGTGGCTGCTCTCACCGTTCATTTTC
AATGCGGATGGACTCGACTATGAAAAGACCAAGTCGGACGTGGTGGCGTGGTGCAAGTGGATGTTTATGGACGAGCAAGCGACGGACCCTGACAAGGTGC
ACACTGGCGGGTGGATTTCATGGTGGAAGGGCGACCAGGAGCAGTACTATGCCACCACGGGCATGGCGCGCCTCACGGTCCTCGTGCGCGAATCTCGCCA
TTTCTTCATCATGTGGTACGTGATCACGCTCAAATTGCAAGCCAAGTACGTGCTGTATACGCTCGCGGCGGCCGCGGCCACGCTCGGGGTGCTCTACTTG
TTTCACTTGGTGGGGCTCGCGCTGCGCAAGGCGGCATTTATGGGTCGCGCGGCGCTCTACTTGTTTTTGCTCTTGCTGTTCGTGGTCGGGAGCTTTGTCT
TGATGAACCTGGTGCTGTTCAAAGCCACACCCGACGACGCCTGGGACAAGAGCCTGAGCTTATTCTACGGGTACTGCGCCGCGCTGTACGGGATCAACGA
GATGCTGCGCGTGGCCAACTTCAAGGGCATGGCCGCGCACGACGTGGCCGTGGTATCTCAGCTCGCGTTCTTTTTCGACTTTATCTTTGGCGCGTTGCTG
CTGCTCCCGCTCATCGCGCTCAGTTGCATCCCGTTTATGAATGCGATCCAGACGCGCATGATGTTCAATGAAGGCTTCTCCAAGGCCGTGTCGGCGTCGT
CCCAGCATGCGTTTTCCCTCGCCGCGGCGCTCGGCGCGCTGGTCGGCGTCGCCTGCGGGTGGATGTACTACATGCTCCTGTCTGTGGACCTTGCCCCGGG
GTACAGCATCTACCTGACCACGTACAAGCTGACAACCGTTGAAGCGGGTAAAGGCATGACGTCATACATTACGCTGGGAGGGGCCGTCGTGGGATCGATT
CTAACGAGCTTTATGGGGTACGCCGTCGGCCACCGCATGACGGTGCTCATCGCGGGCATGCTGAGCGTGCTCGGGTGTGTGGCGTTGAGTTTGATTCCGT
CGATGGCGCCCAAGACGGGGTCGCAGTCGCCCCTGGTGCTCTTTGGGGGCATTGGGCTCTTGGCCATTTCGCTCGGTATGATGCTGCCCGCCGTGTCGTG
CTACATTTACGAGATTTCGACGTACGACATGCGCGCCAAGACGATGCTTCCGCTCGCGTTGGCCTTTGTCGTCGGCACGGCCATCTCGTCATATTATGCT
GGCGGCGCCGTGGGCTGGGTATGGCAGTCGTTTTGGTGCGCGCTGCTCATGGCGCTGGTGACGCCCCTCATGAACATGTTTCCCGAGTCGCCGCAGTGGG
TGCTCGAGCGCAAGGGGTATGAAGAGTGCGAGACGGCGCTGAGCATTCTGCGCCAACGCCCCGAGAACACCGCGGAACTGCGCGAACTGCGCGAAGACCA
GGCGCATGCCAAGAAGGACCGCGACGGCGGGTCGGCGTTGTACAAGGCAGGGCTGTCTGTGCTATGCATGCTCATTTCGTCGCTGTCTGTGGGATCTCTC
AATATCTTTGTTGCGCGCACGTTTACCTCGTTTGCCGACGACAACTTGGTATTTACCAACACGCTTGTGGTCGAGGCGTCGGGCGTGCTCGTGAGCTTCT
TCGTCATGGACAAGTGGCCCCACCGCAACCTGCTGACATTCACGCTGCTCGGCATGGGGCTGGGCGCTGGTACGCTGGGAGCGGACGATCTGTACCCGTT
TTTGCAAGGCAATTCGCAGCGCAAGCTCATCACGTCGTTGTTTATGTACGTGCTGTTCTTTATCAAAGGGCTCGGGCTCACGTCGACGATTTGGGTCAAC
GTGACGGGGCTATTTGCCACGAAAACCCGCTTTGTGGCTGTGCCACTGCTATTTGCGCTCTGGTTTGCCGCACCCGCCGGCAGCGTGGCCCTCCGCGTGA
TCAGCTACACCAAGAACGCCTACCTTTGGCTCTTTGCGCTCTCGGCGCTGTGCCTCGTCACGCTCTTCCTTGTTGTCATGACGTCGAACCGCGCCAATGG
ACTCATCTGCACCCGCAACGACATGAAGAAGGACAAGGCCCGCCGCGATCGCCTCCGCGGGTCGCGGCACTCGCGCACCCCCGGCAGCTTTACCCGCAAC
CGCCGCCAGTCGAGATCGGCCCGCCAGTCGCGATCGAATTCACTCGCCAAGTC