Description :
From Genome Similarity Track
Location :
Scaffold_129:21345- 29251
Transcript NameFunction/comments
Hyaar_Emoy2810532hypothetical protein
Hyaar_Emoy2810533isoleucyl-tRNA synthetase

Sequence
7906 bases(100 bases per row)
TCTCATATCTGCGTTACCTTCGGCTTCAATACAATTTAAATCGAATAGCGCACGACTTGAAATCTGATCAATCACGAATGCCGCACAGTCATATGTTACG
GTTGTCAGTGTTAACATCCAGGTTAGACAACATATTGATGGCTTACTGTCATGTTTTATTCGTCGCCCTTCTATCCTTCCTTTTGCATATCGCTCGACAT
GCGCGAGAGGCCTGCGCGAGACCCCACCGCGCAGTTTGGGGTCGACCAATGGACCATCTCCGCCAAAAGATGGGTGGCCTTGAGATGGGGTGGGAGGGTG
CGGCCTGTTTCGAGTGGCTCACTGTAACGGGGCACACTTTATTCAAGTAACTGAATAAACCTTGCACTGCTGACAGTGCAGGGGCGTGTGCTTCCGACTA
CCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTAGAACTGTATTTAGTATAGTTAATCCTTGTA
ATAGATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAATGTGTATTATAACTATCTGCGCGCCACTCGTTGCGTGCTTCTGTCGTGGCTAGACTT
TATTGGTTGATATCTTGATCCTATATCAACCAATGAACAGTGTGTTACATCTGCGGGGCAATATTATCTATTAGGATAATATTGTGAGAAAATTGTGTTT
GTCCTAACGCAATATTCGTACTTGATATTTACCCTAAGTAAATTATCATGTAACGGAGGCACCCCGTTACATCACCCCCCCCTTAACTATCAGTCACATT
AGTGACTGATTGATTATTGAATGACTCTTTTGAGTGGCTCTGGGACAGGGAAGCACTTGTTGGCCAATCCATCCATTCTTCATTCTCATCGCATGGTTAA
CAAGTCCATGCGGTGTGCAGCAAAAGCTGCTGAGAACGCAGCCATGAGACTCTGCTCTGCTGCCGCGGGGGAGACAGGATCACCCGAAGCAGCTGACGTA
AGTTCGTCTGCTGCTTCCGCGACTCAGCCTGCAGCAACTGCTGCAGGCGCACGCGGTGATGCACCGCGTGACATCGGAGATTATGAGCTTGAGCTCATAT
ACTCTGGCAAGTCCGACGGTGAGACCGACTCGAAGGAGGCAAAAGCCACGGATGAGCCAGATTTGGCTAAACCGTAGCCGACTAAGTCATCTTCCCGAAG
CGCTTTAAGCCTCGCAGATCGTCGTGACATCTTCGGATCGTCCGACGAGTCAGACCCTCCATCTCCGAGACGGAGTCGTTCTGCTGAAAGCGAGAAAAGC
CATGGCTTTGGCCATTGGAACGATCTACCTGTATTCTTGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCG
GAATGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACATGACTTCACCCGTTGACATACTTCGCATGCGCGGACGTACTTACGCACGAACTGATACTGG
CAGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGATGCGCAGTA
GCAGGTTACCATAATTCGGTACGACGACACGAGGCGTCTCGCCGGCAACGGCTGTATACTACAGTAAGCCATTGTGGAATATATCTATCTGTGGAGGATC
GATATACTGGGGGCAACCTTTTAAGGGATTGACGGGATGGTTGCAAGAGATGATCCATCAAGCGCACCATCTCTGGATCGTACGCCTTGCGTATGTCTTC
TAGTAAGATTGACGACGGGACACTCGACTTCAATACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCGAAATCGGGCCGGCGCGACAGA
GCATCAGCGACGACATTCAGTCGTCCTGGTTTATATTCCACGAGAAGTTATACTCCGCGAAGAACGACAGCCACCTCGCAATTCGTTGCGAGAGGTGTGG
ACTGTTAACGGTCGTGCGTAAGGACGCATGGTCTGTATATACGACGAAGGGTCTATCACCTAGTAGGTAGACCCTGAACTTCGCCAAAGCATACTTCATG
GCAAGGAGTTCCTTGTCATGGACGGGGTAGTTACGTTCAGCTGGTTGCAGCTGACTTGACTGATAGCAGACGACACGCTCAGCACCGTCTGTGTCGTATT
GCATTAGTGCACGTCCGATGGCAAAATCACTTGCATCGCAGACCACATGGAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGAT
TTGCTTGATACCTTCGAATGAGCGCTGACAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGACGAACAGTCATCTCGGCGTAA
TTGTGCGAGTATTTGTGCAAATACGCCGTTAGGCCAAGGAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCGGCCAGTCAGTGATCACCTTGATCTTTT
CCGGATCGGGCCGGACGCCGTGCTTACCCACGATGCATCCAAGAAGTGTTATTTCGCTTGCAGCAAATATACACTTCTTGAGGTTGGCGTACAACTTATG
CTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGGACTTCCAAATACGTCTTTCCATCCATAGCCCGGCTATAGACGAACACGTCATCGAAA
TAGCTGGGTGCAAATTCTCGCACAGATCTCAACAAATTCGTAACACATCTGTTAACCGTAGCAGGGGTATTACTCAGCCCTTGTGGCATTAATAGCCACT
CCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTATAAGGAATGTCCTTTTCACGCATAAGGATCTGATAGAACCCGTCCATCAGATCCATTGATGAAAA
GATGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACT
ATCCGCCGTCCTCCTGTGGCCTTTCGAAAACAAAGGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCCCACATGGCCCGCAGCTAAGCGATCGGCAAAGA
ATTTGTCAACCGCTAGTACTTGTTCCCGAGGCAATGGCCATTGCTTCATGACACATATCTTTGAACCTGGTTTCAGGTCTATCTCGTGACGAGTACCCTT
ATCCTTGGGTAGCTTGCACGGCACTGTTTCTGGGAACACATCCCTGATTCCATCAAATCATCGTAGAGATGATTTGTCTTGAGCGATTCCCACGATTGGG
ATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAATCCTTTTGTTCTCAGCGAATACCATTGCCGACCG
AGTATCGGTTACGTACTCATCTTCCGCGACGAGTACGCAAATCTGGGTGACTTTGCCACTACGCAGATCACGCAAGAACCTTTTCTGTTCGAGCGTGGGC
AATTGAATGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATTAAGTTGGTATGTTCCTATGCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTG
TTGTCTCCTGGAAACTTATTTCCACAGTTGAGTGGGGACTTATTCCCTCACTAGCCTCTTTGGCTATCTCATCATCTGACACGAGTGGAATTGCTCCCTC
ATTATCCTCTGGCGGTGGTTGTGCTACCGCGGCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAATATCATCGTACTGCCAATCATTGGCAATCGGT
TCATTTTCACTTGGGTGTTGTCCGTTTGGAGGACACCCATGCCCCAGTCCATTCGACTTATTCGGGTGTTGGGCCTTCGGCGCGATCTGCATCTCAATGC
AGTCGCCGGAATCTGACTTCATGTTGTGGCTATCAGCCACTCCATGGCCATGTACAGTCGTGCTAACGACCGAACCACGCGCGAGGCCATCGCACTCGCT
CGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTG
ACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATTATATTGGACTCCCT
TCAGTGTATAGGTAATACCCACTATACGTTACATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATCCTCGTTGGAGGGATCTCTCGCTCAAC
ATATTCGAGCTCTCTTTTGTCTAGAGATTGGCTTCGTACAAAGCTTTTCGACTCCCCACAATCGGCTAGCGCTCGAAGTGACATGCCTTGTGTCACTTCG
AGTTTCAAGGTAATGAGGGAAACCTCCTTACCAGAAGCATCAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAAATCACTTG
ACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGTTACAGTGTTGCGAAAACGCAACAACGTCGGACCCACGC
CTTGGACCTCTCTTGGCCGCTTGGAGGTTACTGTTCCCTGCGGTACGTGTTACCGCGCTCGGGGCACTGCAATCATATGTGTAATGCCCTGTCTTCTGAC
ATCTATTGCATTTCTGCAATTTCTTATAGTTGTTAACACGAGAGCTCTCGCTCCTCGTGTTACAGAGGTCCATTGGATCTGGGCTTCCATTTTCCTGTCG
TCTCGATGGACGATAGGAATTCGAACTCGCGTGAGCCTGTTTCATGCTGAAGCCCTCCTGTTCCGCAACCCTTATTGCCTCTCCTAGGGTGTTGAACTCC
AATCGGAGCAGGTAGATTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTGTGCAACTGG
TAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCAGGAGTTCAGAGTGAGCCCTGAACTCCCCTCGAGGCGGCTC
AAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGATCGTGTAATATAAGACCCAAGGCCCACGTCTTTGCACGCCCTGCC
AAGTTCGATTGAGCAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCCTTATGGCATCGTCTAGTTCCACGAACCATCTCAATAGAGAGTCTT
CATCGGCTCCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTTGGGTCGACGTATACACGTCGACCCGGTAGCAGTGGTCTGCTGCTGTCTCAACAGTTC
AAACTGTTGACAACCTTGTTGGTGAAGCAAGGTTACTTTTTCCCGCTCGGCGTCAAGTTCATTCCGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCT
GGCCCCAGGGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGCATCCCATTCGATTTGACTCAAATGGGAGTAGC
TTTCATGCGTGGGATGAAAATCATCCCCCTCATCGTCCAATATGTTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACGGGGCACACCTTA
TTCAAGTAACTGAATAAACCTTGCACTGCTGACAGTGCAGGGGCGTGTGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGA
GTAAGAGTACTCAGTAAAGGTAAAAAGTAGAACTGTATTTAGTATAGTTAATCCTTGTAATAGATCCCTATTTGACTTCATTTAACTATGTCTAAATACA
AATGTGTATTATAACTATCTGCGCGCCACTCGTTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTTGATCCTTTATCAACCAATGAACAGT
GTGTTACATCTGCGGGGCAATATTATCTATTAGGATAATATTGTGAGAAAATTGTGTTTGTCCTAACGCAATATTCGTACTTGATATTTACCCTAAGTAA
ATTATCATGTAACGGAGGCACCCCGTTACACTCACTGCAGATTGAGGAATGGAAGGGAAAAAATTAGTAGAATGATTTAGCGTGGTACACATTAATTCCG
TGCTGAAGTGGTGCTGGTTTTGCGACTGGTGCCGGTATTGCGACTTTTGCATCTGGTTAGTGCCGGCATTGCGACTTACTCGCTGATTGGTTATGACTGC
TATAGGTCTTGTGGATACGCTCGTTTGCACTTCAAGTTGGTATAGTATGTAAGCAGGCTTTACACGAGCAGTACCGGATATCTGTCATTCGTGACAAGAT
TTGGACAATGAGGTGGCTCTGTGCTTGATCACCACACTGCTATTGCTTTTCCTTGTCATACCCTTTTACCACAACCATACCATGTGCCACGACGAAGTCT
TGAGACCTGAGATGCTTCACATTTTGCTCTATTACGATCGCATCTCCATGTGCGAGCTCGCCGCTGCTTTTCACCTGCACTACCTCTCGTCAATCAGTGC
CTTGGCCAGGTCAGTGATGCTGCGGAAGTCCGTGACCTTGGCACATCGCAAACACAATTGCGTCCCCTCAATATCCACTTCAGGTGCGTATTTCCAGCAT
CGCGGACACTTGTGCCCCTCGGCCGGGGTCAGCACCAGCTTCACGTCGATCGGGGCATCGCTCGAGACCATTGCCAATTGACAAGTTGCCTCGAACTGCT
CTGCACTCTCGATTGCAGCTTCCGAGTCCACGACTTTCACGCTAGAGCACAAAAACACATCCTCGAGCTCGGAGGAGCTGGTCTCGAGCGGAGACAGCAG
TGCTGCAAGACGTGGATCAGACTCAGACACAACAACATAGACGTTGCACTGGAGCTGACTGCCAACTCGACCTGCCTGGCGCATCCGCTCCACCACTCGA
TTCACTTCAAAGCGCAGCTGACGGATCGCAGTCCAGTCCCGCGACAATTCGTTGTTCTTCCACTCGTCGGCACTCGGCATCCAGCCTTCATCCAGAAACA
CACTGCCGACCACGTCTTCTAGTGAGATATCGCCTTGCAGCCTTGACAGCCAATGAAGGCGGATATCTTCAGCTGTGTGTGGCGCCACGGGTGCAAGAGC
ACGGGTAAGCGCTTGCAAAGAAAGCCACAATACGGTCTGAGCAGAGCGTCGAGTCTGGGAGTTGGCTGCGTCGCAGTACAGGCGGTCCTTGGCGGCTTCC
ATGTAGAAAGCTGACAGATCCGTCGAGGTGAAGTGCGAGAGGGCGTGCTGGGCACGATTGAATGCATACGCATCGTATGCTGCGCTCACTGATAGAGCCA
GCAAGTTGAGCTCATGCAGCATGTACCGATCCAGCGATGACTGCATTTTATCGTGCGGGACAGCGTGCAACGCGGGATCGAAATCCTGTAAATTACCAAG
CAAAAATCGAGCCGTGTTGCGCACCTTACGCAGCGCGTCACTTGCCTTACCAACGACTGCAGGACCGATGCTCACGTCGCTAGTGTAGTCAGTAGTGGCC
ACCCAGAAGCGAAGTACGTCAGCACCGTATGCAGGTACCTTTTTCTGCTTCACTTTCATGGCCCTATGCAATTTGTTGCTCTCATTTTCCAGGTTCGTCT
TCTTGTTAAATCCCTTGTCAGCGACGGGCACTGGCATAGTACAGCCATTGATAAAATCGTTGGGCACGATTGTATTGCCCAGTGACTTGGACATTTTACT
GCCCCGCTCATCCAGAGCAAAGCCATGAGTGATGACGTTCTTGTACGGAGCCGTTCCCTGCATCGCTAGTGACGTGAGTAGCGATGACTGGAACCAACCT
CTGTGT