Description :
From Genome Similarity Track
Location :
Scaffold_11:21344- 23017
Sequence
1673 bases(100 bases per row)
ggagtacaaggatgtactcccggacgagattccttcggagcttccgaaggataagggcgtacagcacgagattgatctcgtgccgggcacgaagtattgc
gttacacggcggtggccactgccgtgtgaacaagttcaagcgatcgacgacttcttcgagagtcgtcgtcttgcaggtcaagtgcgggaataaaagtccc
cgcacagtgccccgatgttctgtgtcaagaaggcacagggcggctggcgcatcgttcatgcgtacaacaagttgaacgatgcaatgatactggcgcagac
gccgataccgcgaaaagatgttatcatcgattcgatggcctttagcactatcttcagtgctctagatttgcgtgatgggttctatcaaatcctcatgtgt
gagaggtacatccctttcactgcggtaagcaatcccagcggtatgctgtgggaatggcccttcatgccgcaggggcttaagaatgcccctgcgacgttca
atatatgtgtgactcatctattgcgctcggtgcgcgacttcgcaccgagctacttggacgacgtgttcgtccacagccgggctgtgaacgggaagacgga
cattgagatccacaaggtgcatttcccgaagctgctagagcttatgaggaatcataagctctatgcgaatctgaagaagtgtatcttcggggcgaacgag
ataggtgtctcgtagggaaggacagcgtgcgccctgacccaaaaaggtaagagtgatcaatgaatggcccacgccatccaatgtgaaggaactgaggcag
tttcttgggcttgccacgtacttgtgcaagtacgtggagaactacgtgggcaagattcgcccgctgtcacagcttcttaagaaggaagctgagtgaattt
ggacgaccgaatgccagggggcgttcgatgcagccaagcagggcttgactgaggctccgagcttggccgtcgccgaccaagaccgtccattccacgtagt
gtgtgatgcatccgctttcgcgatcggatgtgcattgatgtaaacacgatcacgagggccgtgatcgtgtggcctactaccagtcgcgtcagctgaagcg
agctgagcgcaactaccccgtacacgacaaggagctccttgccatgaagtatgcactcgcgaagtttcgagtgtatctacttgggagtaaaccgttcgtg
gtctacaccgaccacgcatcactgcgtacggcgattaaatcgccacacatatcgcaacatatggcgagatggttgtccttcttcgcagagtagaacttcc
ggatggagtacaaacccggaagactcaacgtagtggccgacgcgttgtcgcgtcgacctgattatgcggagacggtcgacgccaacagtgttggcgtcgt
gaggacaagtgtgccgttgattggcgacgtgaaggacgcgtatgcaagggatgcagacgcaaaggagctgctggagttcctcgcagcaccttccgacgag
gcacgccggaagctaactcctcaccttcgagctcgtatacaccgctatcgtgtacacgaagggctactgctgtacagcgcagtagacgacaatgcggatc
gcattgtcgttccggatgatctcgagtaccacgatgcccctacgacagggcatttggatcatgagaagacata