Description :
From Genome Similarity Track
Location :
Scaffold_39:21343- 26074
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012072Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
4731 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGATCTCGCAGTTCT
CACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAGTAATCTCGCGACAAGTTGAGAAACGTTTTCTCGCGTCCGAGATGGCCACTCGAAGGACTG
TCATGATACTCGTACAAGAGTCGATGACGCAGACTTTCATCGTTGGGGACAACGATCCTCGCTGGATCCCCTTTCGTCAACCGCATAATACAACAGCTCA
TTGTGCATGCTGTAACGGTGAACACGCGATCTTGCTCTTGATGGGAGGTTCTGGAGTGCCTCGTCTGAGGGATTCTTGAAATACTTGATCAGTTCTTGGC
ATGCTTCGTCTTGCTTGTAGCCCTCAGTAATTTCTTCTTGGATTGTGCTTGTCACTCCCGTATCAATCGTGTTGATGTCTTCACAGAGTCGACACGCTCC
GTTCGTGTCGTCACTCTTGCTCTTCGGATCATAATCCGGACGTCTTGACAGTGCATCGGCAAGAATGTTTGACTTGCCGGGCTTATAATGCACAACAAAG
TTGTACTCAGCGAAAAAGGAAAACCATCTTGCCATTCTTTGCGATAGGTGAGGCGTCTTTACAGCTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCGA
ACTGCTTTTCACCGAGCAAATAGACTCGAAACTTTGCCAATGCATATTTCATGGCCAATAGTTCCTTGTCGTGGACTGGATAGTTCCTTTCGGCGGGCCT
GAGTTGTCGTGACTGATACGATACAACTCTTTCTTTGCCCTCATCATCGTGTTGCATCAGTGCACACCCGATGGCATAATCGCTCGCATCGCAGACTACA
TGGAACGGCTTCTCATGGTCTGCGAGAGCTAGGACAGGAGCTTCTCTTAAGCTCTTCTTTACTTCGGCAAACGCTGCCTGATGTTCCTCTGACCATTCCC
ACTCATTTTCTTTCTTCAAAAGACTCGTGAGGGGTTGCACTAACGCTGCGTAGTTGCGCGTGTATTTGTGCAAATAGTTGGCCAAACCCAGCCACTGACG
TAGCTGTTTGACGTTCTGAGGAATAGGCCAATCGTCAAAAGACTTGACCTTCTCAGGATCGACCCGAACGCCATTCTTGCCAACAAAGCAACCGAGTACA
GGGATCTCGGGGGCGAAGAAGATGCATTTCTTCAAGTTAGCGTACAGTTTGTTCTCACGCATAACTTGAAAGACTTGACGAAGATGTCCAAGATGAACAT
CGACATCTTTCTTCCCTTCCGAGGCCTTGCTGTGAACGAATATGTCGTCAAAGTAGCTCGGTGCAAACTCTCTTAATGGACGAAGTACATTCGTGACCAT
TCTGTTGAAAGTTGCTGGTGCGTTCTTCAGACCTTGTGGCATCACCATCCACTCCCACAGCATACCACTAGGGGTGCTTACTGCTGTAAATGGTACATCA
CTCTCACGCATACGAATCTGATAGAATCCATCTTTCAGATCGATCGCGCTAAAGACAGTGCTGCCAACCATTCCATCAAGGATCATATCCTTTCGTGGAA
CTGGAGTCTGAGCAGGTATGGTCGCATCATTCAATTTGTTGAATGCATGAACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAAGGTGGGACTACA
GTGCGGAGACTTGCTCTCGCGCACATGACCAGCCTTCTGTCGCTGCGCGAAGAACTCATCGATCGCATCGACTTGTTCCTTCGGTAGCGGCCATTGCCTT
GTGATACAGTACTTTGTTCCCGGAAGTACATCTATCTCGTGACGAATGCCTCTATCCTGCGGCAATTCGTCTGGCACTTTGTCTGGAAATATGTCAGCAT
ATTCCTTGACAAGTCCATACACGGGGTTTGTCTTTAGAGCGTCCCACGACTGCTCATCAAACCTTTCCTTCCGTGTCCTTTCGTCTAACACTTCCGCAGT
GTTGATAGCATCGCCGGCAACTTCATCGACGATCACACAAATTTGCGAAATTTCGCCTTTCACCAGGCTACGCTCAAGCGTCTTCTTGCTCATCAACGGC
AAGGAAATCAATTCTTGAGCCAGACTTGGAGGATTTTCCACTTGCACATGACGCGCTATCTGGCAGTCGCCTTCTTCATTGTAGACTACGACGTTCACGT
ATTCACTTGAAGTGGCTTGTTCCTGCCTCTTCACTTCATCTTCTGCCTTCCTTGTGTCTTGATCAGGGACGCTTGCAGATCTTCGTTCTTCTTCATCGGT
CTTCTTATCTTCTTTAATCCTGTCAGAGCAGAACTCTTTATCGCTCTTGGCCACAGGAGTAGTCTTTTTCTGGCGCCTGACTACTCCACCTCCAGTGGTC
TTCACGGGCTTGTCATTTGAGTGTGAGGGGCCATCGCACGCCTGACTCTCATTATACACATCTTCAACAGATGTATATGCCCAAATCACCTCTCTTGCTG
TCAAGCAGCCGAGGTCTTCGTCGGCTTGCTTGTCGACGCTGATCTTCTTCTTCTTCCAGTCAATGCTCGGTTGGTACCTTCTCAACCAGGGCATTCCCAG
AATCAGATCAAACTTGTCATCGAGGTCGAGTGCTATAAACTCGTCTTCACCTCGGAAATCATCACACTCGATTGCCATACGCAACACGCGCTTAGGCATC
GTCACTTTCGACCCATTCGCCAAGCGAACGATCATTTCCTTGTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCACCACTTGTGTGCGGACAAAATTGT
TCGACGCACCAGTGTCTACAAGAGCCCGTAGAGGTTCTGAGTAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACACGCTCACA
TCTGTTGGCGGAAACTTCATGTGCGTTACACACACCGGGGCAAGAGTTCTGCGCTCCCACGACATTCACAGAACTCTTAGTTCGCCCAGTAGGGAGCCCC
GCTCCTACTGGTCGTTCCCGTTTTTTGGCTGTTGGGAACGCTCAAATTGTCGGCCTCTGCCTGGTCGATTCGATCGCGGACCGTGCGTCGCTTGCTGGCT
TGGCAAGGACACCTTGCAATTTCTCGCGATGTGGCCGGGCTTGCCGCAACGGAAACACTTCCCGTCATTGCGTGGCTGTCGACTTGCAGTCACATCGGCA
AACGAGATGTCCATTGGCTCTGGGCCATTGTATGTTGTCGCTTGTTGTCTTGGAGGTCGAGCGACAAAACCGCCGAACTTGGCTTGCTTGATGCTGAATT
CTTCTTGCATCGCTCGCTCGATAGCTTCATCCAGCGTCTTGGGGTACTCGCGGAACAATTGGTTCCGAATTGGACCATCATTGAGCCCTGCCATGAATGT
CACAACTTGTGTTGAGGCATCAATCGGCTCATTCACGATACTTGACACAAGGTATCGTGCTCGTTGAGCGTACGAGTGTAGGTCGTATTTACCCTGACGA
AGCTTTAAGAACTCTGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGTTCTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTG
GCTCCGCCAATCGCTTCCCATACGCCCAACTTTTCGCTCAACCCGCAAGTTTTGACATTGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGC
AGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACATCGAGCTTCAGAGGTGCTACTCTCATC
GTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGATCTCGTGATGCATGAAACTCGTAGGGCGCGTTCCTCTGCTCATCCGGTGACGCTGATTTC
AGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCATACGCTCGAGGGCTGCCCACTCGTGGCTCGACAAATGAGGAAAATGCTCATTCGTCAGCT
CCACGGCTTCTCCAGGCATCGAGCCCATCGGCGTCTCAATTCCTTCCATTGTTTCTCACAATCGGACAGGGGTCTTGGAATGTCTGCGCACGCTACACAA
GCGGCCTATGCAGACTCTTGACTTGGTCGTTGGAAGGACTACGAAGTGCTACCAGGTGTAAGAGGCTATCCGAGACAGCCTCAAACACAGCACGCACGCT
TGCGCTTGAGAGGAAGACTTGAGAGGAACTT